Gene detail

Detailed information of XP_074608558.1 in Acropora palmata

Genomic Location: NC_133894.1:4095890...4121483
NR annotation: XP_015761612.1, PREDICTED: uncharacterized protein LOC107340750 isoform X1 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074608558.1

ATGACATCTTGTACACTAAGTCTTTCTGATGTAGAGACTCGCGTCTCGTTTTTACCGAAGAAGTTAGCAGATTCTTCGCCAACACTCGTCAACAACAACAGATATTCGGCTACAAACTTTACGAAAGTGCTCGAGCAGAATGGATATTGTGGCGATTCAAGCTCCGAAGACGGCAAAAGCGAGGCCTTAACGTCTCCATATAAAGCGCCGTTTATTAATGAATTGCCGTCAAAGATGCCAGAATCATCTTGGAATGACATGAGTCCACCTAAAAATGGAAGCCATTTTTTGAATGAGCAGAGAAAAGGTTTCAAGCCAGTTGCTGTTGTTAATGGCTGCGCTAAAGAAAGAATTTCCACACCATTCAATGGATTCCACTACCAAGAAACAATTAAGGCAATACCTGAGAAAACTGTTGGACACGGAAGGCCAAGATATCATTGGCAGTCACCTCGAGTCTGCTCAGCTACCGAGTCTGCCCCTGGCGGTCATGGTCAAGGTGAAAGAATATATGAACAGATTGCTGGAAGAGTGAGGCCCGGACTCCAAGGAAGATCCAAAGAAGAGTTAAACGGGTTCAACTTTGTGCCGATGGAAGCAGCGAATTATGAGGACTCACTGGTGGTGCAACAGAATGGAAACTGCACTTCTGGAACGACACGTGACTTGTTCTTACGACACCGAGGATCAGATGTTACAGAATTTGACACTCGAAGTGGACACTTCAATGGAACAGCCGATCAGCATCAATCTCGCCGTCGTTTCTATAGTGAGGATGGAACTTTTCATGATTTCGGAAAAGTGAACCTTCGAGAGGAGATGCCAGTGGAAGACACTGGCATGACTAAACTACAACTTGAGCTGTCAAAACGACTCGAATTCCCTCGAATGAATGTTTGGGGTCATTGCGCTCGTACAATATCAGAAGATGTACCGCTCGACCGAGGAGAGAAGAGGATTTTCGAATTGTTGAGAAACAATGGACCGTTGGTAGCTGGAGACATAGCCACGCTGGGAGTTGATACAGAAGACCGTGTGAATCACTGTCTGTTTACTCTGTACAGGAGAGGGCTTGTTGAGATTAGCAGATCCAGCCCACCTCTCTATGCTGTTAGTGATTCGTTCCTGCACAAGGGTCCCAGAAGTCCAGGGGTCATTGGCGCAGAGAGAAAGCAGGAGACGTTTATCCGAGGACGAAGCCACAGCGACGACTGGTGTGAACGGCAAAGGCGACATTCGTATGGCTCTCGTGAAAGTAGACAAAGACAGGAATCTCGAGTAGTGGACAACGCGAGAGCGTCGGTCAGATCCAATGGACTACACGGTGCCATTCCAAGCGAACCGCGAATCTCGCCCTATTTCTGCAAGTACTGTAAACTGCCGTTTCAATCCGCTGCACAATTCGAGGAACACCTCCAAAGCACAAAACATCAAAACAAATATGCAAAGTACAATGCCGTGCCCTACAGGAAGTTTTGCGAATATTGCAAGGTGCATCTGAATTCGGAGTCGCAAGCCAAAGAACATTTCAACAGTGGAAGACACGAGCAGACAGTTGCAAAGTCACAGAAGGCACCTCTCAAACAGCACCTGCCATTGGTCTCGTTCACGCAGGAGCCCTACTTGGAGACCACCACCAGAACAGAGCCATACTCTTACCAAAGGGAATTGTATGGCAAGGCAATGACGACAAACTCTGTGTGTTTCCTACCAACAGGTAGTGGAAAAACTCTAGTCGCAGCTTTGGTAATTGCCCATATGCTTAAGCTCAATCCATGTCGCCAGGTGGTGTTTCTCGTCGATCGAGTCTTACTTGTTCTCCAACAGAGTGACTATCTGAGAAGCGAGTTGTCACATATCCGAGTTGCCGATGAAGGGAGCTCCAATTCGTTCAACGGCACAAGACCCATTCGCATCGGTGCTGTGTGCGGTGAAATGAGAAAACTGGAAGGAAATTCCCGTATCTATGAGCAAGATGTGTTGATCATCACAGCTGACTGTTATAGAAATCATCTCAACAACGGAACGCTTCGTTTCGAAGACGTTTCGCTGATCGTCCTTGACGAAGCCCATCATTGCAACAAAGATCATCCATACAACGTGATCATACGGGACTTTTACCTTCGAGAAGACGATCTTCTCGGTCATCGCCCTAAGGTCCTGGGCCTGACTGCATCGCCAGCTGGCGAGCTTTCGTTGGACAAGACAACAAAGCGGTTGCAACGTCTCTTGGGAAATCTGGATGATGCGAGGCTCTTAAACGTGTCACGCAGTATCCAGAAACTGGATGAAAAGACAAATAAGGCGCCTCCAGAGTGCGTGACAGCCTTGTGCACACCACCGGAGGAAGAGCTGAGGGATGCCCTGATGGAATACGTGACCAAAGCCTTCAACTTGACAGTTCGTTTAAGCGAGATGAAGGACTACAAAGATATTTTCCAGCCCTCGTCAGGTGGACTGTTCAGCATAGACGACGTCCACCCCGTTCTTCGTGTCACGGACAAAATAATTCTCTCACGTCCAGACTCTAATGCTTTGAGTGCCCTCCTACATTTCCAGATCATTTGTGAAGCCATCTGTGCGCTGCAGGAGTGTGGAAGACAAGTAGCACTGAACCAAATGGCTGAGCTTGCAGGGGAGGGATGCCCTCACGGGTTCCAGTGGGCAGAAAGCATGGGCTTACCTTCCAGCCAACTCTGTTCACATTTTGATCAATACTTCTGTCCAGGTTTGCTGTGGAGACCCAACCTTGCTAGAACCGCATCTGCCGCAGATCAACTTGTTGAGTACTTATCAAAAGAGACCTGGCACGGAGTGTGTGGTCAAAGAGCTGCTTGGGTCCTCGTTTTGGTCACTCGAAAGCGAACAGCCAGCCATCTCGCAAACTACTTGTCGAGCTCCCCCCAACTTCAGGCTCGTGGAATAACGAGCGTTTGCTTGGAAGATCAAGGAAGCGGCTCGGGTGAGCAAGATTTGGTTGCTTTTGAGCCTGGAGAAGTACTCCAGCAAATTTGTGATGGATTTGTTCAAATTGTTGTTTCTACGAGCGCCCCTGAGGATAGTCTCGGTTTGCCAAGTTGCCAGTTGGTGGTCCAAATGAATCCTCCTAGTTCTACTCAGGCGCTTACGCAAATACGCGCCCGAAGCCAGGCAGCAAGGTTTGTGTGCATCTCCAGAAACGAGGAACAGGCCAAAAAGATTGAAGATTTGTTACGACGAGAAGAGAACATGAAACGTGCTGTAAGAATCCTAAACGGGTTGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7S8J7	Dicer-like protein 1 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) OX=367110 GN=dcl-1 PE=2 SV=1
A4RKC3	Dicer-like protein 1 OS=Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) OX=242507 GN=DCL1 PE=3 SV=2
Q1DKI1	Dicer-like protein 1 OS=Coccidioides immitis (strain RS) OX=246410 GN=DCL1 PE=3 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005652 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12171 all species →	zf-C2H2_jaz	Zinc-finger double-stranded RNA-binding	Family	Interproscan
PF04851 all species →	ResIII	Type III restriction enzyme, res subunit	Family	Interproscan
PF12874 all species →	zf-met	Zinc-finger of C2H2 type	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR051363 all species →	Family	RIG-I-like Receptor (RLR) Helicase	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR013087 all species →	Domain	Zinc finger C2H2-type	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR022755 all species →	Domain	Zinc finger, double-stranded RNA binding	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR036236 all species →	Homologous_superfamily	Zinc finger C2H2 superfamily	Interproscan
IPR006935 all species →	Domain	Helicase/UvrB, N-terminal	Interproscan
IPR003604 all species →	Domain	Matrin/U1-C-like, C2H2-type zinc finger	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14074 all species →	HELICASE WITH DEATH DOMAIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074608558.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074608558.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

79TPM > 0

2Conditions

85.0Max TPM

39.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	43	31.17	61.33
all_coral_tissue · baseline	38	36	49.49	84.98

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.33
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	58.76
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.35
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.78
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.06
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.60
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.34
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.30
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.84
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.82
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.35
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.72
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.51
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.43
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.83
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.93
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.36
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.78
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.13
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.57
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.92
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.79
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.63
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.39
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.25
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.42
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.34
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.77
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.76
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.51
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.36
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.31
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.79
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.11
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.05
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.89
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.23
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.21
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.14
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.15
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.40
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.25
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.42
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	84.98
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	78.10
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.84
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	68.98
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	68.09
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.31
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.33
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.32
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.67
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.62
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	59.03
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.32
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.78
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.88
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.93
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.64
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.91
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.47
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.68
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.57
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.24
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.68
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.64
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.47
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.42
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.21
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.49
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.96
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.41
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.22
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.20
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.79
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.68
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.69
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.91
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.31
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.