Gene detail

Detailed information of XP_074608804.1 in Acropora palmata

Genomic Location: NC_133894.1:14723861...14763074
NR annotation: XP_044172182.1, regulator of nonsense transcripts 2-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074608804.1

ATGAGTGAGGAAAAAAGGAAGGCAAGATGTGGCGAAAAGAAAAAAAATTCGGCAAGTCCAAAGTTTGGAGGAGACGAAATGAGGAACACTAACAAAGAGACCGCAAAAGACGTGAAAGCTCCTGAGCTCGACAGCTCAGGGAGCGAGAAAGATACAAGTGAGAAACTAAAGAGTGATGAGGAAGAGGCTATGGCTTCCAACAGCAAAGATGCTAAGGTAGAGAATGATGATGCAGCTGTAAAGCAAAAGGAAAAAGAAGATGAAGAGGAACAGCGCAAAGAAGAGGAAGAAGTACGACAGTCCTTAAAGGAAGCTCAAGAGCAGATGGAACAGAAACTTGCAATGAGAGAGAAAAATCTGGCAGCTAGAGGTCAGCCTCTTGAGGAGTCGCATTTTAAAGGACGTGACTCTTCTGTCAAGAAGAATTCTGCATTTATAAAGAAGTTGCGGACAATTACAGAAGCTCAGCGTGAGTCTTTGGAGCAAGAATTTGCTGGATTGAATCTTTCAAAATATGTACAGGAGGCGGTTGCTGCAATATTGGATGGGTTGACAAAACTTAAGCTTGCAGATGTGAGATGCATGTCACATATTTGTGGCTTGATTCATCAAGAGTACAATGACTTCAGTGAGCCTCTCAAGAAGGGAATCATGAAAACGTTTGATAACTATGGTGGAAAAGAAGAGGAAAAGCAAGCAAATGTAAGCAAATATCGTGTTTCTCTGAGACTTCTGGGAGAGCTTGTCATTTCTGGAGTTTTTCCAAAGCTTCCTGAAGGCATTAAAATGCTTCACACTGTCTTGAGTAACATTGTCAATGCGGACAAGGAAAGCCACTCTTATGTGCCAGTTATCATCAGCTTTGCACGTCACTGTGGTGAAGATTTTGCTGGCTTCACATCAAGAAAGCAAAGACTTTTGGCCGAGAAACACAAGGTGGTCTTTCCAAAGTGCCACATTGTGTCAGCTGATGATCAAGTAGCCATTAATCAGCTGTTGCTGAGTTATTACAAGTCATTGGCTGGTCATTTAGTGGCAGCTCACAAAGATCTTCACAACAGAGAGAAGCAGAACAGACAAATGCTCATGACCAAAGGTGAACTGCACCCAGAGAGAAAAGAGTCGTTTGAGAAAGCACAAAAGGCGTATGAGAAGCTTTTGGTCAACACATCGACTTTGGCAGATATACTTGATGCTGACATGCCGGATTTGCCACAACTTGAACTCACTCACCAAGAAGTTTCAGGGAACTCTGTTGATGTTTTCAACCCTTTTAGAAATAATGAGTCTGATGGCAGTTCTGGTTTGTGGGAAGACGAGGAAGTGCGAATCTTTTATGAAAATCTCAAAGATCTAAAAGCATTCTTGCCAGCGATTTTGTACAAAGATGAAGGAAAAGCAGATTCAGAAAGTGATGCAGAAAGTGTTAAAGATGAGAAGCCAGCCATCAAAGACTTGGAAGTGACAGAAGACGAGTGCAGTGATATGGAAGAAGACTTTGGTGATGAGAATTTCATTGAAGCAGAAAGTGAAGAAGAGGATAACGATCCATCGAAATCAAGCGTAAGCAGTGGAGCAGCTCTTGATGCCATACTGCTCAGATTGCCAACATGTGTTAACAAGGATTTCATCGATGAGGTGGCGACAGAGTTCATGCAAACTTGTAACAACAAGGGAAACAGGAAGAAACTATGTCGAACTCTTATTGCCGTGCCAAGGATAAGGTTGGACCTGTTGCCGATTTACTCGCGTCTTGTAGCCACCCTTGACCCATGTGCTCCAGATATTGCTCCAGAAATGATCAAGCAACTGAAGTCTGAATTTAGATTTAGGTTGCGCAAGAAGGATCAGGTTAATGTTGAATCCAAGATTAAAGTGGTCAGATTCATAGGTGAACTAACAAAATTCAACATGTTTCCAAAGGGGGAAACTTTACACTGTTTGAAAATGCTCCTAGAAGACTTCACACACCACAATATTGACATGGCTTGCAATTTGCTGGAGGTGTGCGGTAGATTTCTTTACCGTTCACCAGAATCACACGTTAGAACTAGAAACTTGTTGGAGCTGATGATGAGAAAAAAATCTGTACAGAGTCTGGACAGTCGCCAGTTGACGTTGATTGAAAATGCTTTCTTTTATTGCAATCCTCCAGAAAAGCAAAAGGTTGCCCAGGTTGAACGTCCCCCAATGCATGAGTACATTCGTAAACTGCTGTACAAAGACTTGTCTAAAACCACCACAGAGAAGGTTTTGCGTCAGATTCGGAAGCTGCCTTGGGATGACCCACAGATTGTGCTGTACGTGATCAAATGTCTCATCCGTGTTTGGAACGTCAAGTACAACAGTGTTCACTGCGCTGCCAACCTTCTTGCTGGAGTAGTGCAGTACCATGAAGAGGTTGGTCTGTATGTTGTTGATGGGATTTTGGAGGAGATCCGCCTTGGAATGGAGACGAACTTACAGAAGATGAACCAGCGGCGTGTTAGTTGTGTCAAGTTCCTGGGTGAGCTGTATAACTACAGACAAGTAGAGTCACGTGTCATCTTTACCACCTTGTATTCCTTCATAACCTTTGGAAACAATCAAGAAGGCGTACCATCAGTGTTGGATCCCTCAGAACACCTCTTCCGTATTCGTCTAATCTGCACCCTGTTGGATACCTGTGGACAATACTTCGATCATGGCAACTACAAGAAGAAACTCGACTGCTTTTTAGTTTACTTTCAGTGTTATATCCTAAAGAAGAAAGCTGATGCGATTTGGCATGAAGGACATCCCTTCCCTCGTGACGTCGATTACATGGTGGCAGACACACTGGAGTCCCTTCGTCCAAAACTCACTATTTTCACTAACCTTGAGGAAGCTGTGCAAAACCTGGAGAAGCTTAACAAAGAGCATCAAGAGCAAATCGAGAAAGCCACTCCCGCTGAGCAGGTCAATGACAGTTCACATCCATTACCCATCCAAAACACGCCCCACAGCAACGTGGGAACCAGGTCTCCAGCTGCCTCGCTCGGTACCTCTCCTTGCCAGTCTCCCATGCTGCGCGAGGAAGATGAACTGAGTGGGACGTGGGAGAGTGAGGGAGAAGACGAGGATGCGGGGCCTGACCCTCACGGAATGGAATCCGAAATCAATTTGACGGAGGTGGATATGAGTGACATGGATATGAACAAGGTCAAAGTACTCAGTCCTCCAAAGCTGGAGCCCACAGTGGAAGATAAAGAATTCCTGGCTGCCTTTGATAAGGTGATGTTGGATGACATTCAAAGTCGCCGTGAAGAAAACCTCAAGGTGCCTAGCTTGGATGTAGCCGTTCCAATGCACTTGAAAAGCCAAAGGATGCGCCGAAACAGCTTACCGGAAGAGAGTGACAACTTAAACTTTGTTATCATGTTGAAGAAAGGCAGCAAGCAGCATTTCAAAAACCTAGAGATTCCCGTTAGCTCAGGACTGGCTGCCAGCATTAAGGACAGGCAATTGGCGGAACAACAAGAACAGGAAGAAGTCAAGAGATTGGTTCTGGACTACAATCAAAGACAAGAAGAGGAGATTTACAATGAAATGCTGGCCGAACAACGACAGAGTATGGCTGACCAGGCACCCAGATCCCACCACCGCACGCATAAGAAACGTCTTCCAGAGGGCAACGACACCAGTCTTGTGTTTGCTAACTTGACAAGGAGGCGTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2AT37	Regulator of nonsense transcripts 2 OS=Mus musculus OX=10090 GN=Upf2 PE=1 SV=1
Q9HAU5	Regulator of nonsense transcripts 2 OS=Homo sapiens OX=9606 GN=UPF2 PE=1 SV=1
F4IUX6	Regulator of nonsense transcripts UPF2 OS=Arabidopsis thaliana OX=3702 GN=UPF2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003459 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04050 all species →	Upf2	Up-frameshift suppressor 2	Repeat	Interproscan
PF02854 all species →	MIF4G	MIF4G domain	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007193 all species →	Domain	Up-frameshift suppressor 2, C-terminal	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR003890 all species →	Domain	MIF4G-like, type 3	Interproscan
IPR039762 all species →	Family	Nonsense-mediated mRNA decay protein Nmd2/UPF2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12839 all species →	NONSENSE-MEDIATED MRNA DECAY PROTEIN 2 UP-FRAMESHIFT SUPPRESSOR 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000184 all species →	Biological Process	nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005844 all species →	Cellular Component	obsolete polysome	Interproscan
GO:0035145 all species →	Cellular Component	exon-exon junction complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14327	UPF2, RENT2; regulator of nonsense transcripts 2	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074608804.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

75TPM > 0

2Conditions

63.7Max TPM

32.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	41	29.09	63.74
all_coral_tissue · baseline	38	34	35.49	63.65

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.74
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.10
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.13
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.34
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.79
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.09
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.95
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.44
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.70
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.92
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.26
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.50
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.27
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.15
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.58
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.59
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.40
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.18
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.69
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.41
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.32
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.97
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.08
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.85
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.71
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.43
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.36
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.95
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.79
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.81
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.32
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.43
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.05
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.10
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.52
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.57
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.49
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.87
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.71
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.49
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.08
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.65
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.36
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.95
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.29
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.72
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.69
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.66
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.14
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.93
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.22
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.72
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.56
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.70
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.41
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.56
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.53
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.51
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.90
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.87
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.62
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.88
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.61
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.93
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.92
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.63
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.79
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.12
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.18
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.59
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.47
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.61
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.02
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.79
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.08
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.