Gene detail

Detailed information of XP_074609158.1 in Acropora palmata

Genomic Location: NC_133894.1:17802735...17805514
NR annotation: XP_029192881.2, general transcription factor 3C polypeptide 4-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074609158.1

ATGGCGGACGCAGAGACCAAAAACAGCAAATTTAAAGTTATTGAAACGGTGAAAATAAGCTATACCCCTTCACATCCAAACGCTATTTCGTGGTCACCAGATGGCCGTTTATCTGTGATAAGCGATCGGTGTGTTTATGTCCTCACTCCGATCTCTTCGCCATCTCATCCTAGTTTGAACTTGGAAAGGACTTCCATTCCTGCCAGCAAAAAGCCCTTTCAAGTAGATGTCGGAATTGATCGCCGACAAATCAGTGCGGAAAAAAGTCCTGGATGGCAGTTAGACCCAAGGGTCAATAGCTACATTGTTCAAACCCCTGTTTTTCAAAAAGTCGCATGGTCACCGCTCAACTGCGATGAAAGTAGCAGATGTGTAATCGCAATTCTGTTTTCAGATTTCCAGCTTCGAATTTATTTGTGTCCAAGTGCGAGTGCAGGTGTTAAGTGGAGAGAAGCCTGTGATTTGTCGTATCTGTTGAGCAGTTATCTTAAATCGCACGACTTTGAAATCAGCGAAGATATAATGCAAGGAGACATAAATGCATCAAAGCAACCCGGCTGTATCGGCCAAAAACTGCAGAGAAGCAAGTATTCCCGATTTGTCCAGCGAGTTCAAATGCTTACATTTACTTCATTGCATTGGTTTTCTGAGGTTTATCACGCTGCAATTGACTCTAGCATCACCAAAGTTGTTAATGGTTCCTTTAAAAACAAGCAGTTTGCTTTGTTGACAACAGGGACACAAAGTGGCCATGTCATTTTTTGGAAGGTAACAACACCTGTACAGATCAGCAATCCAAATAGTGTTCAACTGCAGGGGTTATTAAATGTCAATCAATCATGGTCAACTTCATTGGCATGGCAACAAGTGAATGAAAATCAAGGAATATTGGCTGTTGGCTGCTTAGATGGGTTCATAAAAGCTTTTAGCATCAAGCTATTTCCATCACTTAGTGGAGTGGCAGAGTATGTACTATGGGGAGACAAGGATGAGATGCAAGTTCATAATTTGCAGTGGATGCCCTTGAAACAAGAGAAAGACAACTATTGCCTTGTAGCATGCAAGGGATCCTCAGTCATACTATTTTCCTTGACTTCAAGAAATGGTTTCATTGTCACAAAGCCAACACAGAAAATTGTTACCCAAGTCCACAGAATGCCAATCACTGGGTTACACTGCTTACAAGACGGGACCATTTTCACTTGCAGTTTGGATGGCTCAGTGCAGATGTTAACAGATGATGCAAACGTATCAAAATCTGTCGATTATGATGACAGTAAAGGCTTCTCCTGCCATGGAATTGGAGTATCAGCAAATGGTGTCTTCGTAACATTGTTTCTCAGCCGTACTGATTACACTCGTAAATTTTTGGAATGGCATGAAGCTAAAGTTCTTTTTGTGAACACTGCTTGTGGGTTACCATCAGTCACTCAGCTTTTAAGCAAGGATTGCCTTCAAATGGAGAAGAAGTGGGATGTTTGCAAGGCCATTCAGTATTTCATCCATCGCTCCAAAGCAGCCAAGGAAGAGTTCCATCAACTTGTTTTCATGGAGGATTTAGAGAGACTTTCACATCCCCGACTGATTCTAAGGCAACATGTGCTTACGTTGATTGTGTTAACTTCAAAGAATGATACTCAGGAAGTCAACAAAATTCTTGGAATTGACATTTCAGATCAGCTTGAATGTACCATAAATTACTTATACAAACATCTGGCAACCGCATTTTTAAGAAATTGGATGAATGCACGAGAGCAAGCACCTGGCAGTAATTCAGACTCAGTTGCGGTATTAGTGACCTGTGATTGGTTAGTGACGAAGTTCTCTGATTCTGCTTCACTTGATTTGGCGAATGAGGTCTACCAGGTTTTCAATGATGGGGATGGCCTTAAATTGCTTTCCTCACTTAAAGAGAAAGTGGACGTGCACATGTCATCAAGCGATGAAGCACAGATGAAGATCCAGGAAAGCAGCAGAGAACTCACACAAAATGGAAAGGAACAAATTACAGAGCAACTTGTAGATTCAAATCCAACCCTACAACAAGATGTGGTTGTGTTGAAGAATGCATGCGATAACATACCTGCCTTACCAATGCGAGAGAAATGCAAGATCTGCAAGAGTGGCATTCCTCTGGAAAGTGCAACTCATGGAACTTGTTTAAATGGACACAAATGGCCACGCTGCTGTGTCTCATTTGTTGTCTGTACTGATTTAAAGCACAAATGCTGTCAGGATTGTAGTTGCTGTGTCTCAAATCCACATTCTGGCTCATCTACTTGGTTGAGAAATCTCTTAGAGGCAACATTAAAGTGTCCATTCTGTTTCGGATTTTTTCGTGCATGA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005336 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12660 all species →	zf-TFIIIC	Putative zinc-finger of transcription factor IIIC complex	Domain	Interproscan
PF12657 all species →	TFIIIC_delta	Transcription factor IIIC subunit delta bet-propeller domain	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR024764 all species →	Domain	Transcription factor IIIC, putative zinc-finger	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR024761 all species →	Domain	Transcription factor IIIC, 90kDa subunit, N-terminal	Interproscan
IPR044230 all species →	Family	General transcription factor 3C polypeptide 4	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15496 all species →	GENERAL TRANSCRIPTION FACTOR 3C POLYPEPTIDE 4 FAMILY	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000127 all species →	Cellular Component	transcription factor TFIIIC complex	Interproscan
GO:0004402 all species →	Molecular Function	histone acetyltransferase activity	Interproscan
GO:0006384 all species →	Biological Process	transcription initiation at RNA polymerase III promoter	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11310	GTF3C4, KAT12; general transcription factor 3C polypeptide 4	EC:2.3.1.48	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074609158.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

74TPM > 0

2Conditions

16.8Max TPM

2.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	2.34	16.77
all_coral_tissue · baseline	38	34	3.18	8.87

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.77
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.43
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.60
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.75
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.80
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.39
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.99
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.75
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.56
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.42
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.39
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.38
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.79
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.66
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.64
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.61
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.56
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.41
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.37
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.31
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.30
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.27
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.24
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.15
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.11
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.98
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.97
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.86
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.75
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.75
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.68
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.59
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.56
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.54
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.39
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.33
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.22
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.18
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.16
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.14
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.87
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.52
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.15
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.20
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.18
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.39
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.36
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.27
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.99
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.69
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.52
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.45
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.75
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.69
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.64
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.53
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.49
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.43
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.42
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.10
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.69
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.65
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.57
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.21
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.18
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.12
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.68
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.36
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.03
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.91
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.89
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.80
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.75
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.24
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.