Gene detail

Detailed information of XP_074609461.1 in Acropora palmata

Genomic Location: NC_133894.1:3474674...3491512
NR annotation: XP_044183094.1, acylamino-acid-releasing enzyme-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074609461.1

ATGGCGGCGGACGGCAGTGTTGAGGAGTTTGTCAATAAAGCTGTAGAATGCTACAGAGATTTTTCAAAGGCAGGATCTCTGATGTTAGGAAAAGTTGCAGTAATTAACCAAGGTTCAAACTCGGGAACAGCTGAGCTGAACGTTACTTCCCTGTGGTCTCAGCGTGATTTGGACAGAAATGCAAATCGCACTTTTCTCAGAAGCCACATTGGTAACTTTGATACAAATTCAAAGTCTTTCAGTGATATCAGAGAGCCGTCCTTTCCTGTGGAACTTCAAAACTTACTATTGTGCAGTGTTTCACCTACTGGTAGGATGCAAGCTCAGTTACGGAATGTTCCAGGGAGCAAAGGGAAAGAAGACAAGCAGTTTTTAGAGATTTGGTCTAAGAGTCATCTTTTAAGGAGCATTGATGTGCAAGCTTGCGAAAAGCATGGAAAGATTTATGAGGATCCACAATTTAGTTGTCTGGCCTGGTCAGCTTCTGAACGTTTCTTGTTGTATGTGGCTGAGAAGAAACTGCCAAAATCTGTGTCATATTTTGAGCGCCAAAACCCAGATGTCTCATCAGACAAACCAGCGCCACAAAAGGGAACACAATTTGATTTCAAGGAGGACTGGGGTGAGCAGCTAATCTCCAAATGTTGTCCTGTTCTTGTTATTTACGACATGACAACTGACGAGATCAAAGTGTTGGAAGGTGTACCTGAAAACATATCAGCTGGTCAGGCCTGTTGGGGACCAGATGATGATAGTGTTGTATTTGTAGGATGGTGCCATGAACCTTACAGACTTGGTCTCATCTATTGTCCCATCCGGCCGAATGCGTTGTATTCTTTGTCCTTGGATGGAAAAACTCTTGAACAACTTAGCGACAGCAAGCATTCAGTGTACTCCCCTCGCTTCAACAACACCATGGACAAGCTGATGTACATTTCTGTCGACGTCGGAGGAGCGCATCTTAAATGTGGGAGAGTAATGCTGTACGAATGGAAAACCAAAAAAACTTCAACAATTGTTGACGTGGTGGATATCCCAGAAAGGGACGAATTTCCTGGGATCTACCATCCCGGCCGATTGTTTTCACAGCGTAATTGGACCAATGATGGTTCGAGTGTCGTCATGACAACTGCATGGAGAAGTTACCAGAAAATTATTCTGATCAACTGCAACGACAAGTCGGTGAAGCTGCTTACTACTGAACCCGGTTGCTGGACTTTCCTCGATGTGAGCAACAACATACTGTTGGCAGAATTTTCTACACCCACCACCGCACCTAAACTGATGATGGCGGCCTTGCCAGAAGTCATCCCGGAGGATGGCCTTTCCTGGACAGTTGTCGCGCAAACTGCCGAGTTCAGTCTTGAGAAGGAAATGACATGGGAAGTGCTGTCATTTTCACGCAGTGAAACTTCAGATATTCAAGACGAATATGAAGCTGTATTTCAAAAGCCTGTTACGGCAAGCGGGAAAAAGCCAAAATTGATTGTCACACCCCACGGAGGACCACACGTGAACTTCAATTCGAATTTCTGGCTTTACAACGCTTGTCTCTGTAAACTTGGCTTCGCCGTACTAGGAGTTAACTTCAGAGGATCTTTGGGGTTTGGTCAAAAGTCTCTTCATTCTCTACCTGGAAATATTGGAACTCAAGATGTCGAGGATGTACAGTATGCTGCGAAGAAGGTTCTCGAAAGCGGTCAGGTGGATGACACAAATGTGTTCGTTATGGGTGGCTCCCACGGGGGATTCTTGACCGCTCATCTCATCGGCCAGTACCCGGATTTCTACAAAGCGGCCGCAATGAGGAATCCAGCTTTGAATGTAGCAGGGATGCTTGAAATGTCAGATACACCAGACTGGTGTTATTTCGAGGGAGGGTATGATTTTACATTCCAGAGTACCCCAACGCTGGAGCTACAAGCAAAATTGCTGCAAGTCTCACCGTACGTTCATTTTTCAGAGATAAAAACTCCCACTTTGCTTTTTCTGGGAGCTGATGACGTACGCGTTCCTCCAAAACAAGGAACGAATTTTCATCGTCTCTTGAAGGCCAAAGGAGTTGAAACCAGATTGCTATGGTACCCTGGAAACAATCATCCCATCTCCAAGGTGGATGCAGAGAGCGATGTGTTTGTCAATTTAGCTAGGTGGTTTTTTGAGCACACCCAAAAGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P13676	Acylamino-acid-releasing enzyme OS=Rattus norvegicus OX=10116 GN=Apeh PE=1 SV=1
P19205	Acylamino-acid-releasing enzyme OS=Sus scrofa OX=9823 GN=APEH PE=1 SV=2
Q8R146	Acylamino-acid-releasing enzyme OS=Mus musculus OX=10090 GN=Apeh PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002446 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00326 all species →	Peptidase_S9	Prolyl oligopeptidase family	Domain	Interproscan
PF19283 all species →	APEH_N	Acylamino-acid-releasing enzyme, N-terminal domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029058 all species →	Homologous_superfamily	Alpha/Beta hydrolase fold	Interproscan
IPR011042 all species →	Homologous_superfamily	Six-bladed beta-propeller, TolB-like	Interproscan
IPR001375 all species →	Domain	Peptidase S9, prolyl oligopeptidase, catalytic domain	Interproscan
IPR002471 all species →	Active_site	Peptidase S9, serine active site	Interproscan
IPR045550 all species →	Domain	Acylamino-acid-releasing enzyme, N-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42776 all species →	SERINE PEPTIDASE S9 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0008236 all species →	Molecular Function	serine-type peptidase activity	Interproscan
GO:0004252 all species →	Molecular Function	serine-type endopeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01303	APEH; acylaminoacyl-peptidase	EC:3.4.19.1	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074609461.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

84TPM > 0

2Conditions

71.9Max TPM

31.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	46	25.34	54.84
all_coral_tissue · baseline	38	38	38.14	71.89

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.84
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.03
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.10
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.87
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.09
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.69
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.30
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.82
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.17
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.01
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.42
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.31
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.89
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.56
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.36
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.33
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.20
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.29
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.59
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.43
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.32
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.93
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.39
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.87
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.12
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.11
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.82
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.72
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.66
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.29
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.83
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.53
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.11
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.30
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.45
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.74
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.18
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.45
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.11
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.99
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.77
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.41
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.31
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.76
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.95
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.41
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.89
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.68
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.81
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.75
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.64
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.25
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.92
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.70
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.92
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.10
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.61
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.36
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.68
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.22
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.01
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.37
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.29
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.48
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.22
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.52
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.02
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.50
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.11
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.79
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.60
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.06
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.29
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.68
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.50
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.89
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.74
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.48
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.25
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.80
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.32
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.16
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.96
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.93

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.