Gene detail

Detailed information of XP_074609652.1 in Acropora palmata

Genomic Location: NC_133894.1:17698803...17711584
NR annotation: XP_029192889.2, uncharacterized protein LOC114959133 isoform X2 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074609652.1

ATGGCGAATATCAAATCAACCGAAACTGAAGTAGCCGTCACACATGGAGGCACAAGCGCTCGAGGAGTTGGGGTTAAAGTTTCTGTTCCCTCTGCCGATGGAAATGGAACTGAAGAAAGCTGGGGTTCTGCAAACTGTAAATGTGCAAGTCACTCTTCCAACAAAGTTACACAACAAAGCAAGCATAGCACCTCCCAAAATTGCTGCTGCAGTCACGAGGTACATGTGCCTGGTATGGTGTATCAGCATGTTGCACCACCAGTGACAAGCGTGATGATTGAAGGGTCAAAAGCAGCATCTCAAGACTCTAAACTGGCATCGAAACACTACTGCTCTAGCTGCCCCCCAGGACCACATACTCACCATGTATACTCCCCACCTGGCTGTCATCCACACCAGCCTGCGGCATTCATGGAGCATGCTCACTGTGGCTGTCAGCCGGGATATGTGGATGGTCATTTTCACTTCCCTCATCAGCAGGCACCTGGGCGACCTGTTGCAGTGATGGCAGCCCACCCACCTCCTCCCCTCCTCGTACGACCTGTCCAACCACAACATATGCAGCAACATCAGGCTATCCTTGAGCAAGAACTTCGTCCTTATTTTGATGGCAAATGGAAAGGACTTGGAGATCCTCATTTTGGGGCAAGAGGTCATTCCTCAGAGGGATCAATGGGTGCAGGCGCCTTCATCAATGAAACACAAACAGCATCCCAGCATCAACCTCTGTTTCATCATGGCATTTGCCAATGGCCAGGCTGTGAAGCCTTCTGTGACAATTTTCAGCAATTTATGCATCACCTTAATACAGATCATGCCCTTGATGAAAGAAGCACAGCTCAAGCAAGAGTGCAAATGCAAGTGGTAATGCACCTAGAGCTTCAGATGAATAAAGAGCGTGAAAGGCTATCAGCAATGATGAATCATCTTCACACGCCAAAGGTTTCGCCAAAGTCGCCAACCTCAAACTCTGAACTTGAAGACGAGGTTTCTAAGCACTCGCCTCACTCTCAAGCTCCGCCTCATCATCTTCATGATTTACACCCCTCTCCCCACAGTCATTTGTCCACACTGGATGGTGCTCCATCGGCGCAGCATTCAACAAATCTTACTACCAGACAGGAGGTTCCCTTGTCACCTCAAAGCCCTCTCCCGACTATGGGGTCTCCCCTAAGGAAGCATCCCCTCACCCCTCCTCCTAACATCACTGTGCGTGATATCGCAAATTCCGCGGTTGATTCCATTGCGATCGTAGGCACAGCAAGCTGTCACATGATGGACGAGAAGCCTCTTCACGTGAAAAGAAGGAAAGGAGACCCGGATGGAATTGCTTTAGACATCCAGAGATCAGCAGACTTTTATCAAAAGGCTGATGTGAGACCACCATTTACTTACGCGTCCCTGATTAGACAGGCTATTTTACATGCCCCTGATCAACAATTGACGTTGAACGAAATTTATTCTTGGTTCGTTCACCAATTTGCTTATTTTAGGCGGAATGCGGCTACTTGGAAGAACGCTGTCCGTCACAATTTGTCTCTTCACAAGTGTTTCGTCCGCAAAGAGAACGTGAAAGGAGCAGTGTGGATCGTCGACGAGGATGAATACATGAAACGAAGGCCACAGTCGAAAGTAACTCACAGTGCAGCGATGGTGAGGCAAGAGAGGGAACGATTGTTGCAGCAAGGCTCCTTAGGGGGACTCCCCACCCAAGTGAATTTGCTTCCAATGGTTACCCCTAGTTCCAATGACGTCAGTGATGAAGAAGGCTCTAGTCACGAGGAAAGCCGAAAAGAAGGCTCGGATGAGGAACCTGGGGAAGAATTACCACCCACGAAACACAGGAAGCAAAAAGAGGGCGAAGAAGCAGAAGGCGTGGTCGGCGGAATCACGAAGTTAGTGGAGTTCTGTTCAAAGGATATCAACAGCCAATTGTCTCAATCTCAAGTTCAGGTCAAGTTGGAGCCTCCAGAAGACGGACCAATTACGGCATTGAACGGCGATAGTCACTCAGAGGAAGGTCAATACCATTCTCTCATGAACGGGAGTAGTCTGATGGAGACTGGAACTAGCGAAGATGAGGTTAGGCAAGGCAGATCAGCTGATAACGGACTATGGTCTTGTAACGAGCTCTACAGAGAGGACAAGAAACGAAGGACCACTCCAACTTACGATTGCGCAGTAGAGACGATAATTGCAACTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A4IFD2	Forkhead box protein P1 OS=Bos taurus OX=9913 GN=FOXP1 PE=2 SV=1
Q9H334	Forkhead box protein P1 OS=Homo sapiens OX=9606 GN=FOXP1 PE=1 SV=1
Q58NQ4	Forkhead box protein P1 OS=Gallus gallus OX=9031 GN=FOXP1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002206 (this species only)
Transcription factor family	Fork_head · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00250 all species →	Forkhead	Forkhead domain	Domain	Interproscan
PF16159 all species →	FOXP-CC	FOXP coiled-coil domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR030456 all species →	Conserved_site	Fork head domain conserved site 2	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR050998 all species →	Family	Forkhead box protein P	Interproscan
IPR001766 all species →	Domain	Fork head domain	Interproscan
IPR032354 all species →	Domain	FOXP, coiled-coil domain	Interproscan
IPR047412 all species →	Domain	Forkhead box protein P1/P2, forkhead domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45796 all species →	FORKHEAD BOX P, ISOFORM C	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0043565 all species →	Molecular Function	sequence-specific DNA binding	Interproscan
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0001227 all species →	Molecular Function	DNA-binding transcription repressor activity, RNA polymerase II-specific	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23582	FOXP1; forkhead box protein P1	-	Transcription factors	ko03000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074609652.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

77TPM > 0

2Conditions

107.0Max TPM

38.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	42	41.46	107.00
all_coral_tissue · baseline	38	35	35.02	66.84

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	107.00
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	105.73
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	101.36
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	83.02
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	80.48
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	74.78
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.33
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.44
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.04
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.92
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.62
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.92
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.40
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.33
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.08
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.69
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.09
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.34
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.18
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.08
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.58
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.42
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.13
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.02
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.30
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.88
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.84
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.42
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.35
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.89
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.83
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.73
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.09
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.33
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.43
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.08
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.34
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.14
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.06
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.69
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.15
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.44
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.84
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.34
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.09
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.69
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.52
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.83
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.66
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.79
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.69
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.46
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.25
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.83
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.76
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.05
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.80
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.66
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.47
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.45
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.08
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.83
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.32
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.51
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.57
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.45
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.45
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.83
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.68
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.36
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.31
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.41
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.25
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.69
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.15
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.82
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.