Gene detail

Detailed information of XP_074609945.1 in Acropora palmata

Genomic Location: NC_133894.1:13971661...13975095
NR annotation: XP_029199700.2, macrophage-expressed gene 1 protein-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074609945.1

ATGTTGTCAGCAATGGCGTTAGTTAAAATATCACTTTGTGTCTTACTTCTTTTCTGTGCCGAGTTGGAATCAGTATCTGTATTCGCTGGGAATGATTCAGCTTTATTTCCCAAAGCTTTTGGCGACCCAGGACGCTGCCCACTCACAAAAGGAATGTATCGCTTCGAAGTTCTCCCTGGTGGAGGATGGGATAATTTAAGAAATCTACACATGGGGGCTGTTTCTGTGGTGAATTATTCAAAGTGTAAAACATCCGATGACGGTAAATATTTAATTCCAGATAACATATTCCTTTATCCAATAAAGAAGAGCAAAGTGGAAACTTTCGCTGAGTTTTATGATCACTGGAAAAACTACACCCCAACCACATCACGGTCTGTCAACGCTGAAGCTTCACTAAAGTTCGGCGGATATTTTAGCGTCAGTGGTTCGTATTCGTCCGACTTCGAATCCGTTAAGAAGCACCAAGTTGAAGACAAATCTGTCACAACTCGAGTCCAAATGCGCCACGTCCTGTACACAGCTAAACTTCAACCCGATATGGGTCTTCAGCCCGCTTTCAAAACGCGTCTATTAGAAATCGCCTCTCATCTGCAGCATAACAATACCGCATACGCCAACTTTCTCGCACAGATACTGGTCCGCGACTTCGGAACGCACTACATTACAAGCGTCAACGCTGGTGCGGTTATCGCCAAAGTAGATCACTTGACGCGGAAATATTTTGAAGATTTTAAAGAAGATAAAAGCAAGATCATGGCATCAGCGAGTGCTTCATTCTTCGGAGTCATTGGCTTTCAAGCAAGCTACAGTAAGTCAACTGGTAAACAAGATTTGGATGAATACACAAATAACACCGTCTATTCTACCTTGTACACGTTCGGTGGACCGCCATACAGAGTGAATTTCACTATCAATCAATGGGAAGATCAAATGGTAAACGATCTTGTCGCGGTTGATCGTGCAGGCGATCCATTACATTATGCTATAATACCAGCAAGCTTGTCCGAGCTATCGGAGCGATCAACCTTTGAGTTAGCTGATGTAGTTGAAAAAGCTATTGAACAGTATTACAAGCACAACACTATCAAAGGATGCACGAAAATGGACTCGCCAAACTTTAGCTTCCAAGCTAATCTCGATGATGGATCTTGCGAAAGCCCCACTAATAATTACACTTTCGGGGGCGTATATCAAACCTGCGAATTTGACGGGTCTCCAGCGGGTAATCCATGCGAACTCCTCCTTCAGAAAAACCCCCTTACAGCAGACTACAAATGCAGAGAGGGATACGACGCGGTTTTGATTCATCAGGGTCGCACTCCTCAAAGCTGTCATCGTGACTGTCACGGCTGTTGGGTTATCTTTATGTGCAATACTAATTGTGGATATGCGACCTACTCAACCTATTGGTGCCTTGCCAAGGCCGAGGTGCCTCTAAATACAGGCTTCATGTTTGGTGGAATCTACAGCAAGGTGTTAAAGAACCCTGTGACTCAGGACGCAAGCTGTCCGCTTAAGTTTTACCCTCTCCGCTTTGGAGCCACAATGCATGTTTGCGTCAGTGATGATTACGAGCTTGGCTATCAGCTGTCGGTCCCATTTGGCGGTTTCTTTAGTTGCAGTGCAGGTAACCCGCTCGGATTAAAAAAATCCGCAGTACGCGATTCACAGGGTCAACCAAATTTGGAAAGGTTTGTCAGTCAGTCCGGCCCTTCTGGTTGGCCAAAATCCTGTCCAACTGGCTACGCTCAACATCTGGGCGCTATTGAACAAGACTGTGAGATAAACTACTGCGTGAAATCTCATGTATTCAACAGTCATGGATTACCAATTATCAAAAGGCCGCCCTACATGGGTATACCTAAAATTGTTAACTTCTCCGTTCCGCTAATGTATATCAACGAAGACACCGGTCAGATCTGGTTTAAACGCCACGGTATCTCTCCTCAGTGGCTCCTTGCAACAAAAGACTCGATTATGGAATTTTCAACGCTAATCAACATCGATGGTCCCGCTATAATTGGAATTGTTCCCGCCGCAGATGACTTGATCACCGCTAAGCATGAGAAACAAAAGCCTTCCCAGAGTTCCAGTGATGCCATGGGTGCGGGAACGGCTGCTGGCATTACATTTGGCGGCACCATATTGGCTGGATTGTTGATTGTTGCCATGGTGATTGGTTGGCGACGTCGTAAGAATATGAGCACCCCAAGCAGAAGAGTGACGGACCCCCTGATCCCAGTAGAAGGCTATGGAAGTCTGCAAGATGCAAATACTGACAAAACTGTTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q2M385	Macrophage-expressed gene 1 protein OS=Homo sapiens OX=9606 GN=MPEG1 PE=1 SV=1
Q5RBP9	Macrophage-expressed gene 1 protein OS=Pongo abelii OX=9601 GN=MPEG1 PE=2 SV=1
Q2KJC3	Macrophage-expressed gene 1 protein OS=Bos taurus OX=9913 GN=MPEG1 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002171 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01823 all species →	MACPF	MAC/Perforin domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020864 all species →	Domain	Membrane attack complex component/perforin (MACPF) domain	Interproscan
IPR039707 all species →	Family	Macrophage-expressed gene 1 protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR31463 all species →	MACROPHAGE-EXPRESSED GENE 1 PROTEIN	Interproscan

Gene Ontology

No Gene Ontology signature was detected for XP_074609945.1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26547	MPEG1; macrophage-expressed gene 1 protein	-	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074609945.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

83TPM > 0

2Conditions

15.8Max TPM

4.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	45	2.78	12.12
all_coral_tissue · baseline	38	38	5.90	15.78

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.12
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.44
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.04
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.88
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.66
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.20
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.75
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.05
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.03
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.96
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.55
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.40
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.96
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.73
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.23
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.73
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.59
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.58
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.35
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.34
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.14
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.59
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.49
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.45
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.41
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.36
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.09
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.99
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.99
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.96
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.89
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.78
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.77
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.66
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.58
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.50
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.45
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.42
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.37
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.37
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.30
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.30
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.26
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.14
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.13
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.78
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.49
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.05
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.43
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.35
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.38
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.34
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.40
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.70
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.22
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.33
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.82
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.77
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.53
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.42
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.40
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.31
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.21
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.15
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.76
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.74
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.62
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.57
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.54
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.20
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.64
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.58
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.33
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.08
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.06
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.85
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.58
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.50
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.27
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.25
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.71
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.16
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.75

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.