Gene detail

Detailed information of XP_074610690.1 in Acropora palmata

Genomic Location: NC_133883.1:9605251...9621666
NR annotation: XP_029212816.2, glutamate receptor ionotropic, NMDA 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074610690.1

ATGGATCGCTGGCTTGTTTCAATGATTGTGACATATTTGTGTGTCGTAGTCGTTTTTCAAGCACGTTGTAAAGCGACCGTTTCTTTCGGAATTGGGGCGATGCTTTCGTCTTCAGAACACAAGAATAACTTCAGTGACGCAGTGAAGAAAATCAACGCTGATTCAAGTAATGTTTTCAAGACGGCAAACTTCAGTGCAAGCTCGTTTGTTTTGAGCTCAAACCCTATCCGCTCAGCAATGGATGTCTGCGAAAAAGTGATTGCTAAAGGAGTAGTGGCTGTGATCGTGAGCCATCCAAGAGATGATACGTCGCCGCCAATCGCCATATCATATGCCTGCAGTTTTTATCATATTCCGGTTATTGGGATTTCGACACGAGAGACAATTTTCTCGGATAAGTCCCTTCACGACACATTTCTTCGGACTGTTCCTTCCTATTCTGATCAAGCCTATGTTTGGCTTGGCCTGCTGAGACATTTCAGATGGAACAAGGTCATCCTGTTGACCAGTAATGACCAGGACAGCCGCATGATTGCTACAAAGTTTACAGGCTTAGCTGAGAGAAATAAAATCAAGATAGAGAAAACAATCCTGTTTCCAACAGGTTGTATAAATGCCACATCTCAGCTTGTGAAGCTGATAAAAATGCAGTCACAAGTCATTTTATTCAGTGCGAGTGAGGAAGATGCAACTGTTGTGTATCGAAATGCTTTTCAACTTGGAATCACTCGACGTGGCTATGTTTGGCTGGTGACAGAGCAATCCTTTGCAGGAACTGCCAGAAACAAACTTCCTCAAGGTGCTGTTGGCATGAGGTTGTCTTATGGAAATAATGAATCTGCTCAGGTACAAGATGCTGTCAGTCTTGTTGCCAAGGCACTCAACAGACTGCTGACAGCCAACAGGAGCCTAACTCCACCCACTTCCAGCTGCAAAGAAACAAGCCAGTGGGACAGTGGCCAGATTTTGTTCCATGAACTTGTTAACACTACACTTGAGAATGGTCGGACTGGCAAGCTCTTGCTGAATGGAAATGGTGACCGTATCAACTCAGTTTATCAGATCCTTAACCTAAAGAGCAGAGATGACAAGGAATTAACAGTAGTTGGGGAGTACAGAGATGGTCAGGTGTCAATCAAAAATGAAGCCATTTCTTGGCCAGGAGGGAGAACTGAGCGACCAGAGGGATTTCTCATTTCTACTCATTTAAATGTTGTGACACTGGTGGGGGAACCTTTTGTATTTATCACTACAATGCCAAGAAGTGGAAGATGTGAGGACCTTGATACCGCCAATGGCCAAGAAAGGCACATCAAATGCTCTGGAAAGGTCTACGGCGAGCATGCCAAACTGGTGACTTCTGACAAGAATGATCACTGTTGCTATGGTTTTTGCATGGATCTTTTAAAGCGACTGGCTAAGAAAGTGAATTTCACTTTTGATGTTCATTTGTCGGAGGATGGTAGTTATGGCTCTCTGAGACGGGTGAATGGTACAGATATGAAACGATGGAATGGTATGGTTGGAGAAGTAATTGATGATAAGTCTGATCTTATCGTGGCTGCGTTGACTATCAATAACGAGAGGGCTGAATGGATTGAATTTTCTAAACCTTTCAAGTATCAAGGACTCACCATTCTTGTCAAGAAGGATCAAAGTAGTAACCGGCTGGATTCATTTCTGCGGCCCTTCCAGATAAACTTGTGGTTGCTTGTTCTTCTGTCAGTTCATATAGTAGCCGTGATACTGTACTTGCTAGACCGGTTTAGCCCGTTTGGTCGGTTTAAACTTGCTCGGAAAGAAAAGGAAGAGACGGCACTGAATTTATCCAGCGCAATGTGGTTTTCGTGGGGGGTGTTGCTGAACAGTGGCATCGGAGAAGGCACACCTCGCAGTTTCAGTGCCCGCGTTCTCGGGATGGTCTGGGCGGGGTTTGCTATGATAATCGTTGCTAGCTACACTGCTAACCTGGCCGCATTTCTCGTCCTTGATCGACCTAAAGCTGTGGTCAGCGGTATCGACGATCCAAACTTGCGTAACCCCTCTGGAGATTTCAAGTATGCCACTGTGGCCAATAGCAGTGTGGATGCGTACTTTCGTCGACAAGTCGAACTGTCCTCTATGTACACCTTTATGGAAAAATACAACGTTAAAACTGCCAGGGAAGCTATACAGAAAGTCAAGAATAATGAATTGAAGGCGTTCATCTGGGATTCCCCGGTACTTTATTACGAAGCTTCCCAAGATTGTATGCTTGCCATTGCTGGTGAGTTGTTTGGCCGGTCAGGATACGGCATTGGTATGCCAAAGGGGTCACCTTGGACAAACAATATATCACTTGCCATTCTTAATTTTCACGAGAGCGGTGTAATGGAGGAGCTAGAGACCACTTGGATCGACTCTAAAAATTGCGCCGAGCAGAGTAATTCTCCCGCTACCCTCGGACTGAGTCACATGTTGGGTGTGTTTATTATGGTGGCAGCCGGAATCGGCGCCGGAGTGGTGATTATTATCCTAGAAATCCTCTATCACAAGCATCGCGGATGGAAAGAAGAACAGAAAGAAATTGCAAAGAAGACGACAGACAAATGGCGAGCTAACATTTTGATGATGAAGAAGGAAAGAGCCACCAATGGACGACAACCCAACGGTGTGTTGGACTCACATGCTCCGCAGACTGATGGCATAGCTCGCCGGAATCCTATTTACAACCCTGAGAATCACGTGGATGGCACGTTCACGTATACCTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0A1L8F5J9	Glutamate receptor ionotropic, NMDA 1 OS=Xenopus laevis OX=8355 GN=grin1 PE=1 SV=1
P35439	Glutamate receptor ionotropic, NMDA 1 OS=Rattus norvegicus OX=10116 GN=Grin1 PE=1 SV=1
P35438	Glutamate receptor ionotropic, NMDA 1 OS=Mus musculus OX=10090 GN=Grin1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000921 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00060 all species →	Lig_chan	Ligand-gated ion channel	Family	Interproscan
PF10562 all species →	CaM_bdg_C0	Calmodulin-binding domain C0 of NMDA receptor NR1 subunit	Domain	Interproscan
PF01094 all species →	ANF_receptor	Receptor family ligand binding region	Family	Interproscan
PF00497 all species →	SBP_bac_3	Bacterial extracellular solute-binding proteins, family 3	Domain	Interproscan
PF10613 all species →	Lig_chan-Glu_bd	Ligated ion channel L-glutamate- and glycine-binding site	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR049873 all species →	Domain	Glutamate [NMDA] receptor subunit 1-like, N-terminal LIVBP-like domain	Interproscan
IPR049872 all species →	Domain	Glutamate [NMDA] receptor subunit 1-like, ligand-binding domain	Interproscan
IPR028082 all species →	Homologous_superfamily	Periplasmic binding protein-like I	Interproscan
IPR019594 all species →	Domain	Ionotropic glutamate receptor, L-glutamate and glycine-binding domain	Interproscan
IPR015683 all species →	Family	Ionotropic glutamate receptor	Interproscan
IPR001320 all species →	Domain	Ionotropic glutamate receptor, C-terminal	Interproscan
IPR018882 all species →	Domain	Calmodulin-binding domain C0, NMDA receptor, NR1 subunit	Interproscan
IPR001828 all species →	Domain	Receptor, ligand binding region	Interproscan
IPR001508 all species →	Family	Ionotropic glutamate receptor, metazoa	Interproscan
IPR001638 all species →	Domain	Solute-binding protein family 3/N-terminal domain of MltF	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18966 all species →	IONOTROPIC GLUTAMATE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0015276 all species →	Molecular Function	ligand-gated monoatomic ion channel activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0038023 all species →	Molecular Function	signaling receptor activity	Interproscan
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05208	GRIN1; glutamate receptor ionotropic, NMDA 1	-	Ion channels	ko04040	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074610690.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

74TPM > 0

2Conditions

52.2Max TPM

24.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	21.81	38.53
all_coral_tissue · baseline	38	34	28.20	52.20

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.53
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.70
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.64
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.84
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.53
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.41
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.39
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.28
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.89
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.33
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.26
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.01
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.94
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.91
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.91
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.56
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.63
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.75
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.15
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.81
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.74
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.49
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.15
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.93
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.70
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.71
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.65
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.02
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.01
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.94
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.84
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.77
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.21
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.44
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.47
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.27
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.77
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.64
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.94
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.90
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.20
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.58
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.25
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.18
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.91
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.44
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.99
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.94
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.51
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.90
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.20
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.89
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.69
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.45
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.97
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.86
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.57
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.88
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.93
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.29
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.60
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.55
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.33
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.05
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.38
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.93
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.70
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.05
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.83
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.16
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.60
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.07
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.01
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.53
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.