Gene detail

Detailed information of XP_074611246.1 in Acropora palmata

Genomic Location: NC_133895.1:1574748...1593146
NR annotation: XP_029213037.2, A disintegrin and metalloproteinase with thrombospondin motifs 12-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074611246.1

ATGATGAAACTACATTTGCTGTTACTTCTCTATTGCTCATGCCTTAATGAGGTAACAAATTCAGCCAAGCAAGATCTGCACACCATTTTATCGAGGGAAGATCTACGTAGATTCTTAGACGCAGAATCACCAGATTCAGTTCCAGACTATGACGTTACACAAGTAATTCATCGCAGAACCAAACGCAGTACTCACACATCCCAGAAGAATCTTTTGTTAGCAGCATTTGGAAAAGACATCGAGCTGACATTACAACGCAATAGAAACATAATCAGCAAAAATGGGTTGACTGTGGAAAGAAGGACCCATGAAGGGTTACTAAGCAAAGAAACACATTTTCCTAAGGGAAAATTTTATGTTGGTCACACAAACTCTGGTTTAGAATCCCATGTGGCCCTACGTGAGACTGTAAGAAAAGGAGAACTGCGCGGTACGATTTTGATGGATGGACATATTTATCAAATGAAGCCTCTAACAGATGATGTTCACAAGCGCGCGTCACTGAACGGGAGTGGATATCACGTGATATCCAGGAGAAGCCTTAAGAGTACTTTCGGCGTTAAAAGCAAGACGTCACCAATATTAGTAAAAGATGAGCAAATTCAGCTAGATGCGAAAACTGCCAAACGAGATAGCAACAACAGTGGACTTGTCTACATAGAGGCTATGCTAACCGCTGACCAAACAACTTGCCATTATTATGACGACGAGACTCTTGACTATCTTCTAGACATAGCAAACTTGGTAAGCAGGCTTTATAAACATGCGTCTATTGGGCTGAATGTGAACTGGGCGCTTGTCAAAGTTTTTCTGGTGGAAGGATTTGATCCCCTTTTAGACATTGCAACAAATCACATCAGAGGAGCCGGACAGTTTCTGGACAAATTCCAACAATGGAGCTCAGAACAAAACACCCCACAGGGAACAAAAGGTCATTTCGATGTAGCTGCTTTACTAACAAGGAGAATATGCGGTCTTGAGCACTGTGATCTGGATGGTCTTGCAGTGTTAAATTCTCCATGCAGTGACTCGGGAGTCAGTATAAACGAAGCACGTGGGCTAGCCGCCGCTTTTACCGTCGCACATGAAATGGCCCATAACCTTGGGGTGGGTCATGACAATGGACAGGATTGTGCGCAAGGCTACATAATGAACAGGATACAGTCATCAGGTCCTAACGCCTTTCGATGGTCTCCGTGTAGCAGACAAAGAATGCAACAAATATTCACGGCAAATCCGTGCTTTCACAACAAACCGCCTTTACAAAGAAAGATGCTTCCTATACCACCGGGTTATACAAAGAACAGGGACAAACAATGCGAGATGGCTCATGGACCAGAATACAGAGTGTGCACCATTCCCTCTCTTCTTGTAAGCTGTGGATTGCTTTACTGTGCTACTAAAGCTGGCGGAAGCTGCTTCGCTCACGGAGCACCGGTTGCGGAGGGAACTGTATGCGGTCATAGAAAGTGGTGCATTGCTGGTGAATGCTCTGATGTCGGCTCCAACCTGCCGCCACCCCAGGATGGAATGTGGGGTCCCTGGAGTAACTACAGCGCATGCTCAAGAACCTGTGGTGGGGGAATCAGATACAGAAGTCGAAAGTGTAACAATCCTGAGCTAAAATACTTTGGAAAGGACTGTGTGGGATCCAGCAGAGGACATTATGCAATGTGCAATACAAAGGATTGTGCTACGGGGAACTTTCGTCAAGAGCAGTGTGAAGAACATAACACGGTTTCCAAAAAATATAAGGCTCATCAAGGGAAAGGTTTTGATAAATGCAAGCTGGCCTGTGTTAGTGGCTGGAACGGATATTTCTTTGGTAATGTAAAAGACAGCACAAGATGTGGACAAGGGCCTTTCGTTTATGATGTCTGCGTTGAAGGAAAATGCAACAAAGTTGGTTGCGATTGGCAATTTGGCTCCGAAAAGGTTTATGATCGATGCTTACTCTGTGGAGGGAATGGTAGTTTGTGTGCGTTGACTGAAGCTACTTACACAAAGAACTATCGTGTGTATGGACCAGATAACGGAGATACCATGGTAATAATTCCCAAAGGAGCAACCAACATCGAGATTCGCGAGAAGGCAAACACAAGAAATTACCTGACTGTTGTGTCAAACCAAACTGGCCAATATTACGTTCGTGTAACTGCCAGCTCAGGTACATACTATGGTGCAGGAACCACAATATCTTACTCCCAGGGACGACCCGGTGATCCTGAGAAGATCTCCATCCGAGGACCAACTAACGAAGCTCTGCAGGCCAAGTTCGTTTACTCGGGACAACAAAGGAATCCTGGTATTCATTACAGTTTTTACACACCTGGAAAAGCAAAGATTACAAAGTTCATCTGGAAACAAGAGATCGAAGGAAGGTGTAGCGCCACTTGCGCTGGCGGAGTTCAAAGGGCGAGGGTCCAGTGTCATCGCGAAGATGACAACACTCAAGTGAGTCCCAATTATTGCGATGTCAACACCAGACCAGCAGATTTGATGCCATGCAACCAGGCACCTTGCCCAAAACAATTTGTACATGGTGTCTGGAGCCCATGTTCAGAAAAATGTGGAGGCGGTCAACAGTATCGAAACCTGACATGCGTACAGGTTGTTTCTAAGAACGACACGCACGTGTTACCTGACTCGGAATGCTCGCACCTATCGAAGCCAGCGGCAATACAACAATGCAATAATCTAGATTGCTTGCCCGAGTGGTACACGGGAAACTGGACACAGTGTTCAGCATTATGTGGTGTTGGTACAAGATATCGTCAAGTAGGGTGCAGAAAAAAACTTGGTAACGGCAGATGGGTCATGCTGGCACGTTCCAAATGCAATGATTTCGGGAGCCAAAAACCAGACAATGCCTCGCAATGTAACGCAGGACCATGTTTCAAGTGGAAAGTAAATTACCCTTGCGCTACTTGTGGAGATTCGGATGAAATGAGTTATGTTCCAGTTGGTTGCTTCCATGACTCGAGAGTGGGTAGTCGACCACTTCCGGAACTGATCTCGAGTTATCGTCATAACATCGAATGGGGAAATATAAATGCAATTGTGGGCTACTGCGCTCATGACACATGGAAGAGACAGTACCCTGTCTTTGGAGTGCAGTTTTATGCAGAATGCTGGTCCGGGCCGTTTGGACACCTTACGTACGACAAGGATGGTTTCAGCTGGAACGGGTGCTGGGAAGGCGTTGGGAAAGCCTGGAATAACTTTGTCTATTCTTTTAAAAACTTAGTGGTGGAGCCAATTGTGGACTGTATAAACACCATTACCAACCAGCCTGTCTCTAGGAACAACTGCAGCTCTCCAATGCCTCAAGCCAGGATGAAACTGTGTTCCCATGTATGCAGCAATGCAACAGGAACTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8TE57	A disintegrin and metalloproteinase with thrombospondin motifs 16 OS=Homo sapiens OX=9606 GN=ADAMTS16 PE=1 SV=3
Q9UKP5	A disintegrin and metalloproteinase with thrombospondin motifs 6 OS=Homo sapiens OX=9606 GN=ADAMTS6 PE=1 SV=2
Q8TE60	A disintegrin and metalloproteinase with thrombospondin motifs 18 OS=Homo sapiens OX=9606 GN=ADAMTS18 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000251 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17771 all species →	ADAMTS_CR_2	ADAMTS cysteine-rich domain 2	Domain	Interproscan
PF00090 all species →	TSP_1	Thrombospondin type 1 domain	Domain	Interproscan
PF05986 all species →	ADAMTS_spacer1	ADAM-TS Spacer 1	Domain	Interproscan
PF19030 all species →	TSP1_ADAMTS	Thrombospondin type 1 domain	Domain	Interproscan
PF19236 all species →	ADAMTS_CR_3	ADAMTS cysteine-rich domain	Domain	Interproscan
PF01421 all species →	Reprolysin	Reprolysin (M12B) family zinc metalloprotease	Domain	Interproscan
PF01562 all species →	Pep_M12B_propep	Reprolysin family propeptide	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013273 all species →	Family	ADAMTS/ADAMTS-like	Interproscan
IPR036383 all species →	Homologous_superfamily	Thrombospondin type-1 (TSP1) repeat superfamily	Interproscan
IPR041645 all species →	Domain	ADAMTS, cysteine-rich domain 2	Interproscan
IPR000884 all species →	Repeat	Thrombospondin type-1 (TSP1) repeat	Interproscan
IPR010294 all species →	Domain	ADAMTS/ADAMTS-like, Spacer 1	Interproscan
IPR050439 all species →	Family	ADAMTS and ADAMTS-like	Interproscan
IPR045371 all species →	Domain	ADAMTS/ADAMTS-like, cysteine-rich domain 3	Interproscan
IPR001590 all species →	Domain	Peptidase M12B, ADAM/reprolysin	Interproscan
IPR024079 all species →	Homologous_superfamily	Metallopeptidase, catalytic domain superfamily	Interproscan
IPR002870 all species →	Domain	Peptidase M12B, propeptide	Interproscan
IPR006586 all species →	Domain	ADAM, cysteine-rich domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13723 all species →	ADAMTS A DISINTEGRIN AND METALLOPROTEASE WITH THROMBOSPONDIN MOTIFS PROTEASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0030198 all species →	Biological Process	extracellular matrix organization	Interproscan
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0031012 all species →	Cellular Component	extracellular matrix	Interproscan
GO:0008237 all species →	Molecular Function	metallopeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08621	ADAMTS6; a disintegrin and metalloproteinase with thrombospondin motifs 6	EC:3.4.24.-	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074611246.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

72TPM > 0

2Conditions

101.8Max TPM

17.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	20.51	101.84
all_coral_tissue · baseline	38	32	14.60	32.07

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	101.84
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.46
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.23
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.70
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.26
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.22
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.15
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.42
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.72
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.32
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.60
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.48
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.07
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.34
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.31
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.93
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.91
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.71
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.87
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.45
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.80
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.66
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.28
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.82
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.43
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.35
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.30
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.28
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.72
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.09
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.76
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.51
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.31
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.54
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.48
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.45
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.28
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.01
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.30
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.07
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.33
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.73
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.24
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.77
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.39
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.01
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.71
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.61
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.54
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.39
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.32
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.28
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.07
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.01
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.90
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.89
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.71
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.67
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.33
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.13
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.11
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.80
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.67
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.08
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.33
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.22
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.23
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.58
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.47
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.97
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.33
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.