Gene detail

Detailed information of XP_074611399.1 in Acropora palmata

Genomic Location: NC_133895.1:9264786...9268841
NR annotation: XP_015759472.1, PREDICTED: uncharacterized protein LOC107338752 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074611399.1

ATGGATAAGTTTGTAGTAAAAACGCCCGCTGTTTCTTCGACCAAGAAGGCAAGTTCCCACCTTCCGCCCAATTTAATAGCTCACGATCGAGCAAGAAAGTATCCCACAGGTACGTTCCACGTGGACGATGGACTGATGTTTTGCTCGTCGTGCAATACTGTGATTGACCATCTTCGGAAGTCCGTGGTTGACAAGCACCTTGACTCAGCGTTACACAAGCAGAGAGCGGAGCGAAACCTAGGCAGCAAACAGCAAACGCTAAAAACGGTGTTAAATTGCAGAACATCAGCGCAAATTGAGAAAGTGAAGATTTGCCAGGAATGGATCAGGGTTTGTGCTGCTGCAAACATTTCTTTGCACAAGTCTGACAACCCATTGATGCGCAAATTTCTGCAGGCACGAGTTGCCAATGGTGGGGCGATCCCTAAATGCTCGCAGTTGCGCGACTGCTACCTGTTCGATGTTTATCAGACAGAAAGAGCTGCACTGAAGGAGGTGGTTGCAAATAAGCAAATTGCGTTGATTGTAGACGAACTCAGTGACAGTGAGGGGAGGTTTGTACTTGATGTTATGGCCGTTTTCCTAGATTTTGATGAACTTTCCCTCAGTGGAAATTCTGTTGCGTGGCTGCTTGATTCTCACTTTTTAACCGAAACAAACAACAGAACAGTTTCACAGGCAGTAGTGAAAACCGTGCATGACTACGGCATAGAGTACGACAACGTCCGTGTTTTCAATTCAGACAACGTGAGCTACATGAAAAAAGCATTTTGTAATGCATTGTCCTGTTTATTTCCCTACTGCATTCACATCACATGTCACAGCCACATCGTGAACCTGGTGGCCTCTGATTTTAAAAAGGCATTTAAGGAGGTAACCGAGTTTGTGAAATGCTTTCGGAATCTTTTCTACGTGCCGAGCGGAAGAAAAAGCCGCTGTATGAAATTTCTTCAAGAAGCCCTAAGTCCAGGTGAGAGTGCCACCATGCCACCAAACCCAACCACTAAAAGCTGGAGTGCCTGGTTTGATTCTGTGCTATATCATGCAGATTACTTCCTCCTCTTCGCAGATTTCATTCAGGAAGAGGTTAACCGTTCTAGAGCTTCCGCTAGTGATTCTCTTCTACGACTGCAAGAGATTTATGAAGATAAAAGCTTTATGAAGAGGCTTCATGTTCAGCTGGCATTCCTTAAAGTAAAAGCTCCCACCCTCATGGCGTATCTGAATTATTTTCAGGAAAGAGTTCCTCATGTTACCCAGGCCCATGGAAAGATGGAGAGACTCCTGCGCTATCTTGATGTAAACAGCAAGTTAGAAGAAAAAGACCTCACCTTTTGTTTTGAAGTGGAGCACACTTTCACAGGTACTGAGAGGAAAGGGTTAGTTTCACTCTTCAGTTCAGCCTTCACTGCTGCCCATTCCAAACTGGAGAAGTATGTTGTTGATGGGGCACAGCCAGGATCAAACTTTCTCGACCAAGTACGAGTTCTTGATCCGAGAAATCTTCTCGATATGGACCATGACTTTAATTCCATTGACAGCATCCCTGGTTTTGATCAAGTTCCAAAAGAAGAGTGGGAGCTGTACGTTAACAACCATGGTCCCCTTGCTGTCAAACAAAGTAAGGATGGTAACATTGACTTGATGCAGTTTTGGAAGGCAAAGGCAAGCACCCTACCTGCACTTTACAAAATAGCGTCGTGTTACTCAACAACAACCATTGGGTCATACGAGGTGGAGAGGTCATTTTCAGCCTACAACGAAATCCTTGACGAGAAAAGAAGATCTCTGGATGAAACTACAATCAGAGCTTTACATTTCCTGAATTGGAATCTTCGTATCATATCATCCATCGAGGAGGAAAAAGAAAAGCAAAATAACCTATCAAAAGGCCATGATGTTACCAGGGAAACACTGAAAACCGTTTCTGAAAGGAAAGCTCCCTTGCTGGGGAAAGCAAGTGACATGTCAATGGTTTCTAAGGATCAACAGCCTGATCCAGTGCCAGCCACTAAGGCAAGAAAGAGAAAAATTGATGTGGCAGATCAAGAAAGAAATGAAGCAGTGTCCAAAAAGAAGAAAGGAAAAAACACACCAGGAAAGCAATTTAGAGGCTCAAACTTGAGCAACTTTCTCAATGCTTCTTGTGTGCACGATGATGATGAAAAATGTCAGCTCCCAACAAACACCCAACAGTGTTCACCAGTCATAAGTGTGCATTATGGAATCAATCAAACAACAGCTCAGAAGTTTAATAATGAAGGAGCCTGTAATTTTCCGGATCACAAACAACCACTTCTGAGTTGTGTGCTAAATGGAACTGTCATCTTTAAAGGAAACAGTGTCATTGATGACAACGACCGGCAGAGTTTGTATGGGCAAAAAACACAAGATGAGGACAATTACCTCTCAAACTTTGTCATTGAAGCCTACCTTCAACTAATTGCAAGCAAGGGAATGTCGCAAGGTACGAAGGTTGAATTCTTGGGGTGGGAGTCATTTGAGAAGGGGTTCAGCAAGGGTTCAGTACAAGAGTACTTGAAAGGAAAAGCACCTTTAATGGAACAAGACATTGTTTTGGTACCTTGTAACCCTGGCCTGAGCAAGCATTGGTTCCTTCTTGTTGTTCTCCCAAAGGAAAAACAAATTCTTGTCTTGGATAGCAAGGCAGCACCCTTTACAAAGCCATCCACTGTAAATGCTGTTGCTAAGATGTGGAGAATACTACAAGAAATTGACAACCGCATAGATGCAAATCGGTGGCAGTTCGCTACAAACACCCCCAAAGATGTTCCACAACAGCAGAACAACTATGACTGTGGTGTATTTCTCTGCTTTTTTGCAAGATCCTTGGTGCTTCAGTCAGCAGTTCCCAGAAACAGTGTTCCTGCCTTCCGATGCCACATGATAGTAGAATTGCACGAGCAAGAGCTGATCAACTTTACGGTGCCTTCTATCCAGGCAAATCAGTATTATGCTGTTGAGTATCACAAAACCTGGTATTTTGGCCGTGCACTTGGAAGTCCTGATGACAATTCTTGTGTGAGTTTTAAGTTCTTGCATTCAACCTTGAGCAATGGTGAGAGGGTTTTTAACTGGCCAAGACGCGATGACATTGACACAGTTCATATTTCATGTGTATTTTTTGGCCCTGCTGTTATTGTTGGCATTGGTCCTTTCAATTTCCCACAGCTGAATGAAGTACAGCAAGTGTACGAGTGGTTGAAGAAATGCAGAAAGGGAACTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UFW8	CGG triplet repeat-binding protein 1 OS=Homo sapiens OX=9606 GN=CGGBP1 PE=1 SV=2
Q8BHG9	CGG triplet repeat-binding protein 1 OS=Mus musculus OX=10090 GN=Cggbp1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000721 (this species only) · gene tree & orthology
Ubiquitin family	DUB\|ULP\|ULP · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02902 all species →	Peptidase_C48	Ulp1 protease family, C-terminal catalytic domain	Domain	Interproscan
PF05699 all species →	Dimer_Tnp_hAT	hAT family C-terminal dimerisation region	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR012337 all species →	Homologous_superfamily	Ribonuclease H-like superfamily	Interproscan
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR033375 all species →	Family	CGG triplet repeat-binding protein 1	Interproscan
IPR003653 all species →	Domain	Ulp1 protease family, C-terminal catalytic domain	Interproscan
IPR008906 all species →	Domain	HAT, C-terminal dimerisation domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR32344 all species →	U1-TYPE DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003690 all species →	Molecular Function	double-stranded DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0010468 all species →	Biological Process	regulation of gene expression	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0008234 all species →	Molecular Function	cysteine-type peptidase activity	Interproscan
GO:0046983 all species →	Molecular Function	protein dimerization activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074611399.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074611399.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

28TPM > 0

2Conditions

0.2Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	14	0.01	0.09
all_coral_tissue · baseline	38	14	0.01	0.16

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.09
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.04
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.03
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.03
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.03
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.03
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.02
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.02
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.02
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.02
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.01
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.01
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.01
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.01
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.16
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.07
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.04
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.04
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.03
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.02
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.02
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.01
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.01
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.01
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.01
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.01
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.01
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.01
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.