Gene detail

Detailed information of XP_074611894.1 in Acropora palmata

Genomic Location: NC_133895.1:1086796...1093173
NR annotation: XP_029213288.2, glycine betaine transporter 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074611894.1

ATGGAAGTTGATCCAAACGCTTTGGAAAGATGTCGCTGGGTTCGAGTTAACTGGAAATGGGGTCAGATTGGTAGCACGCAAATAGGAATATTCCTACGATTCAACCCCGTTGTGACATTTCTCTCAGCTGCGATTATCTGGTTCTTCGTCATTTGGTGCGCAGTTCAGGCAGATGTCGCCAACCGAGAGATGTCAAAATGGATGCTGTGGATCACAGAGACCTTCACATGGATGTATATTGGAACCCAAGACGTCTGGGCCATCTTCATTGTCGTACTTTACTTTTCAAAGTACGGCAAGATGAAGCTTGGAAAACCAGAAGACAAACCAGAATTTAATGACCTGACTTATTTCACGATGCTGTTTGCAGCAGGAATCGGGATTGGTCTCTTTTACTTTGGCGTTGCTGAACCAATCTGGCACTATGAACCAGGAGTCTACGGAAATCGCTATTGGGGCAGGTATAGCGATAATCAACGAGCGCAGGACGCTATTAATTTGACTTTGTTCCACTGGGGTATTCACGGGTGGATTGTGTATGTAGTAGTTGGACTTCTTCTTGCCTTCGTGAGTTACAGAAAAGGTCTTCCCATGACTATTCGATCGTGTTTCTATCCCTTGATCGGTGACAAAATCTATGGTTGGATGGGAGATGCCGTCGATATCTTCTCAGTGGTGTGCACGATGTTCGGTGTCTGTACCAGTCTGGGAATTGGCTGCCAGCAAATGAATAACGGATTCAGACGACTGAACCCGGACATCGAGTTCTCCACAACAAATCAGACCATTATCATTTGGGCTGTGACTGCTTGCGCTACAGTATCGGTTATCACCGGTTTGAAGATTGGTATCCGTCGTCTGAGCGAGATCTGCTTTAGTCTGGGAATGTTCATCATGTTGATAGGTCTGTTTGCGGATGAGACGTGGCATATCCTGAACGTGTACGTGCAGAGCATGGGTTACTACATTCAATGGATAATACAACTCGGATTTCACACAGATGCCTTTGCACAACTTGGAAATGCACCTGACAACAAGCAAGCTCAGCGATGGTTTAATGACTGGACCATCTTCTACTGGGGTTGGTGGATCGCTTGGTCACCGTTTGTGGGTATGTTCATTGCCAAAATCTCCAAAGGAAGAACCATTCGAGAATTCATCAATGGTACATTGACGGCACCCATATTGTACACATTCTTCTGGTTTTGTATCTTCGGAAGCGCTGGACTGAAGATGGAGCGCGATGCTGCCGTGGCGAAAATCAACTGCAGTTCCAAACTGGGCGGAGAAGACTCCACGCATTCGTTTAATGGCCTGTATCGTTTGTCCTGCAGAGGAAAAAATGACATGTGGTTTGATGTGATGGAGCAGTACGGGGATCTCGGAACGTTCCTGTCCGTAATGTCTTTGATCAGCGTTATCCTGTATTTTGTCACAAGTTCTGATAGTGGTTCCCTGGTCATCGATTGCCTCTCAGCCAATGGCGACGCTGAACCTCCTGTCATTCAGCGCATATTCTGGGCCCTAACTGAGGGAGCGACGGCCACAGCTCTGTTAAGGGCTGGTGGGGCAGAGGGCCTCGTAGCTTTACAGTCCATGTCTATAGCATCTGGTGTACCGTATACTATATTGCTCTGCTTAATGTGCGTAGCATTATGGCGAGCAGTTAAGATGGAAGGCGGTGATCTTGATCCTCATGGCCCAAAGTTCGCAACCGGTCTACTGGATGTCCTGAGCAACCCAACAAAAGAGAGTGCAGGAAAGGTGCTGTTGGCCATTTTCGCGCCATGGTATTCAACGGGCAAGGCAGCCTACAAGATCGGTGATAGACAACACAAGAAATGGGTTTACATGTTGATGTTAGCGGTCCCCTTTTATCTTTGGATCGTCCTGATGGCCCTGGAGCCAGTTGTTGCTGCAATCTCAAACGTTGCATGGACTGTGCTCTTCATATTTTTCGCATACGCAACATCTATCCGTTACTACATACGCGAGAAATACAAGATCAATGGCAACATAGTAGAAGATTTCTTTGCAGTGATGGTGTTCTACCCATTTGCAGCATTCCAAATGGAGCACCACTTAGAGCATGCCTACGATCTGGACAAACCAGTTCACGAGATCGGTCATGCCTTGAATCATAACCACGACGACAAACCCGGCCTTGGGTATGCCACACCAACTATGTCACTCCAGGATATCTCCTCAAAAGGATCTCATTTCAACCCAATGTCTCAAGAGGGAGAAATCCAAAACGATAATTTAAACTGGTCCAAAACTGAAGTAATTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q87NG3	Glycine betaine transporter 1 OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) OX=223926 GN=VP1905 PE=1 SV=1
Q87PP5	Glycine betaine/proline/choline/ectoine transporter VP1456 OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) OX=223926 GN=VP1456 PE=1 SV=1
P9WPR6	Uncharacterized transporter MT0942 OS=Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) OX=83331 GN=MT0942 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000606 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02028 all species →	BCCT	BCCT, betaine/carnitine/choline family transporter	Family	Interproscan
PF04749 all species →	PLAC8	PLAC8 family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000060 all species →	Family	BCCT transporter family	Interproscan
IPR018093 all species →	Conserved_site	BCCT transporter, conserved site	Interproscan
IPR006461 all species →	Family	PLAC8 motif-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30047 all species →	HIGH-AFFINITY CHOLINE TRANSPORT PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0022857 all species →	Molecular Function	transmembrane transporter activity	Interproscan
GO:0071705 all species →	Biological Process	nitrogen compound transport	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006810 all species →	Biological Process	transport	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074611894.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074611894.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

77TPM > 0

2Conditions

190.0Max TPM

72.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	41	60.75	148.07
all_coral_tissue · baseline	38	36	85.53	190.01

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	148.07
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	147.97
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	133.43
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	131.01
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	127.20
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	127.14
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	113.79
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	110.99
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	104.49
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	101.34
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	97.67
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	97.09
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	95.01
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	94.17
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	93.67
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	87.38
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	85.62
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.22
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	74.94
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	74.64
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.50
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.17
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.05
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.98
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.79
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.64
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.78
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.38
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.58
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.45
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.45
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.44
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.47
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.81
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.71
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.62
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.14
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.94
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.91
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.38
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.62
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	190.01
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	182.18
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	160.75
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	152.16
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	139.27
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	139.03
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	136.61
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	134.50
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	125.64
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	125.59
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	119.20
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	114.89
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	114.78
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	111.93
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	107.35
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	106.52
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	106.05
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	102.42
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	90.24
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	81.28
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.41
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.39
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.59
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	60.32
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	59.74
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.30
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.38
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.08
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.68
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.74
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.02
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.65
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.11
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.03
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.42
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.