Gene detail

Detailed information of XP_074612166.1 in Acropora palmata

Genomic Location: NC_133895.1:17641645...17666516
NR annotation: XP_029184768.1, phosphatidylinositol 3-kinase regulatory subunit alpha-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074612166.1

ATGGATTCTGGTTGGGCCCAATTCCGTGTTCTTTACAATTTTGAACCCCGTGATCGAAGAGACATCGCCATTGAAGTAGGAGATGTTATGATTGTGGCCAAACCTGTGTCAGACTTTTGCGACTGGCTAACAGGGCATAATACGCGAACACGTGAGGTTGGAGAGTTTCCTGGTACATATGTGGAATATATTGGTGATATAACTCACTTTCCTTCTGTGGAAAATAACCCTCAGCCACCCGTACCTCCTCCTCGGCCGCCAAGAACTCCATCAAGACTTCCAGATTCTGGACATTCTTTGTTTGAGAATTCAGCCACAAAGCCAGTCTGGTGTTACAGATGTGGTGATTTTGTGTGGGGAAATGGAAGCCATGTTTCCAGATGTAAAAAATGTGATTTGTCGTGGCATCCAAAGTGTACCACAGATTTATCTGATATACCTTGTATAATTCGCACAAGAAGGGATGAGGATGATAATGATGATAATGACGATTACATAGATTTAGTTACTGATCCTGAGGAATGGAAGGTCATTGATGTGCTGGTTTGGCTTGCAGCCACAAATCACTACCTCTATGCTGAGGTGTTTAGGGAAAACGAGATAACTGGACAGAAGCTGCGGGAATTGACAGATGTGTCACTCAATCAGATGAACATTACAGACAGCACCCACAAGCAATCCTTACTGCTTGCAATTCAAGAGCTTTTTACTGGAAAATCAGAGAGTAGAAAAAATGACGATTTTTCGGGATGTCAAGTTTCCAAAAGTGGTACTGTGGGAGGTCACTTCTTTAAAGAACAGAATTATGTCACACTGCAGTGGTGCGATAAGTGTGGCAAATGCTTGTGGGGATTGCACCGACAGGGCGTGGAGTGCTCAGAGTGCAGATTCCAGTGTCACAGGATGTGTATGTTTGACAGCGTTGTAGTGTGTCCAAGAGTGAATCGCAGAAGGAGACGTGGGAGTGATGCAGAAGTTCCGATATTTGGAGTTGAACTGGGAGACCAGTTTCGACCTTCCGATATACCAGCACCTATGGTCATGATGAAATGCATTCAAGCAGTAGAGAAAAGAGGTCTCAATTTGCTTAATATTCATGGAATTATCCCACCTGGAAGTGAGAAGAATTCTCTTAGAACTGCATTAAATCAAAATGCCAAGTATGTGAACATGGATGATGAAGAATGGAGAAACCCACACTGCGCTTCTGCAGTTCTTAAGATGTATTTAAATGAGCTGCCTACCTGTGTGTTCACTGAGGAAAGATATGGTTCATTTGTAGGACCTTTCAAAGATGCCAGTACAGAATCCATTGATGAAATGGTCACAGAATTAGTCGAATCTTTACCTGCAGAAAACAAGTCAATGCTTATGTATCTCCTGGAGCATCTTTACAAGGTCAGCAAGAATGTGGATTGGAATGACATGTCCAGCCATAAGTTAGCATCTTTATTCGCACCTCTCTTACTGAGACCAAATCGCCAGGATATCTTGAAGCTGGTCTCAAACCATGAAACGGCGGTTAATATTATAGAGCGTCTTATTCTTAGCGGAGACTGGACAAAACGACCACCAGTACCTCCAAGGAGGAAACCAAGGAATTCTGATATTTTTGGCGAAACCTCTAATGATACCACAGAAAAGCTTCAAGACTGTCCTTGGTATTGGGGGCAGATAAACAAAGAGACAGTCAGCGAGAGATTAAAAGATCAACCGGATGGAACATTCATTGTTCGTGACTCGCGTGCGTTTCCTGGAGAGTACACTTTGACATTAAGGAAAGGAGGTCTGAACAAACTGATCCGTATTTTGCACAAGGATGGATTGTACGGATTTTCTGAGCCTCTGGTCTTTACCTCTGTCGTCAATTTAATAAACCACTACAAGACGAGGTCACTGGCATCCTACAACGCCAAGCTCGATGTGAAACTGGAAACGCCTCTAGATAAATACGAACAGGTGGATGATGATGTTAGAGGTGACGAAGAGAACCAGGAAGAACTCTTTTTATCAAGACTTGAAGCTGCGAACAAAATGTACATACAGAAATCTGATGAATACGAACGAATTCATAATCAATATGTTCAGTCTGAACAGGAAATCACCGATTACCACGAAGAACTCGATGCCCATCGAGAAATCGTAAATATGATTGATGAGCAAATTGCACTGCACGAAAAAACACAGAATGAGGCCCCACCACAACATAGAGCGATACTTCGTCAGAACTTCGAAATTCTGAAGCACAAGAAGCAAGAAGCCAACGGCATGCTGATGACGCTTGAAAGGGAAGTTGCAAACAAGATGGAGGAAACACGTTCTCTTAACAGATATATGAACAATATGAAACCGGAAATAATGAAGTTACAGAGGACCAAGCAACAGTATTACCTTGTCCTCACGACTGAAAAGGGAATGGAAGTAGACAGAATCAAGGAAAGAATTGGAGAAGGGGGACCTAGAATTCTTTCCGGTGTGCCAAATGGCATTTCTGAGGAGGATCCCACGTACGACAGCCCTGAAACGTTTCCTAACAGCCCTAGCGTGGACCTTTCTGAATCGAAATGGTTACGTGGAAGATTGGCCAGAGAAGAAGTGAGAGATCTCTTGCAGCACAAAGCTGATGGTTCCTTTGTGATCAGAGAAAGCACTAACAGGGCCGGAGAGTATGCTTTGGCTTTAAAATACAACAACTGTATAAAACACATCGCTATAGAAAGAGGAAGTAACGGATGCTTCGGGCTTGCTGAAAATCACACTCCTCATCAGACATTGCGTGAGCTTGTAAACTGGTACCACTCGAATTCTCTCCATGTCCACAATCCTCTTCTCGACATTACTCTCAAGTACCCTGTTGAGGATGCACCCAATACCTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P27986	Phosphatidylinositol 3-kinase regulatory subunit alpha OS=Homo sapiens OX=9606 GN=PIK3R1 PE=1 SV=2
Q5R685	Phosphatidylinositol 3-kinase regulatory subunit alpha OS=Pongo abelii OX=9601 GN=PIK3R1 PE=2 SV=1
Q63787	Phosphatidylinositol 3-kinase regulatory subunit alpha OS=Rattus norvegicus OX=10116 GN=Pik3r1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003700 (this species only)
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00018 all species →	SH3_1	SH3 domain	Domain	Interproscan
PF00017 all species →	SH2	SH2 domain	Domain	Interproscan
PF16454 all species →	PI3K_P85_iSH2	Phosphatidylinositol 3-kinase regulatory subunit P85 inter-SH2 domain	Domain	Interproscan
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan
PF00130 all species →	C1_1	Phorbol esters/diacylglycerol binding domain (C1 domain)	Domain	Interproscan
PF00620 all species →	RhoGAP	RhoGAP domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR008936 all species →	Homologous_superfamily	Rho GTPase activation protein	Interproscan
IPR000980 all species →	Domain	SH2 domain	Interproscan
IPR046349 all species →	Homologous_superfamily	C1-like domain superfamily	Interproscan
IPR036860 all species →	Homologous_superfamily	SH2 domain superfamily	Interproscan
IPR032498 all species →	Domain	PI3K regulatory subunit p85-related , inter-SH2 domain	Interproscan
IPR000198 all species →	Domain	Rho GTPase-activating protein domain	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR002219 all species →	Domain	Protein kinase C-like, phorbol ester/diacylglycerol-binding domain	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR051854 all species →	Family	Rho-type GTPase-activating protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46075 all species →	CHIMERIN FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0043087 all species →	Biological Process	regulation of GTPase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K02649	PIK3R1_2_3; phosphoinositide-3-kinase regulatory subunit alpha/beta/delta	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074612166.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

78TPM > 0

2Conditions

86.1Max TPM

39.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	43	37.71	86.14
all_coral_tissue · baseline	38	35	42.06	74.44

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	86.14
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	80.52
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.96
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	73.30
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.81
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	64.51
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	62.89
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.11
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.44
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.17
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.03
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	58.48
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.85
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.84
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.49
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.37
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.59
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.33
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.04
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.10
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.78
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.72
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.36
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.83
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.22
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.63
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.42
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.25
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.75
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.25
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.07
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.07
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.65
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.09
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.52
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.11
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.03
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.09
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.63
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.69
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.52
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.01
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.05
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	74.44
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.41
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.36
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	65.63
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.36
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.37
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.01
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.25
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.75
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	59.94
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.15
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.25
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.18
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.93
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.85
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.73
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.97
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.61
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.54
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.77
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.87
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.54
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.46
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.86
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.89
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.74
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.34
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.70
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.87
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.28
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.21
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.04
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.72
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.42
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.