Gene detail

Detailed information of XP_074612303.1 in Acropora palmata

Genomic Location: NC_133895.1:12017490...12046653
NR annotation: XP_029210487.2, glycogen debranching enzyme-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074612303.1

ATGGCGGCTCAAGTACGTGTGCTTCAATTGGAAGCTCAGCAGAACTTGGAAACAAAATTATATAGACTCGAGAAAGGTTGGAAGCTACGTTTCACTCTAGGCCCATCACTTCAGCCTTACAATGTTCGGTTATTTTGTAACCATCCACTGGACAGTAAAACCTCTTTTGAAAGAAACAAGTATTATGAATTGAAGTGGTCTTGTACAGCAGGAAAACCTTGTGATGATGCTGATAGATTTGCTGACCTTATTGCATGTATAGCTGGATCGTTTCATTTCTATGTTGCATACAAAGATGTTGGAGAGAAAGAAGAAAACACTTCAACAAGTGGATATTTCACTGTGGACCCAATCCTTAGTGTAAACAGTAAAGAAACCATTCCATTAGACTGTGTCAGCTTACAGACTGTCTTATCCAAAAGCCTGGGGCCCCTCACAGAGTGGTATGACAGACTACTGGTTACAAAGGAGACAGGCTACAATATGATTCATTTTACGCCGATACAACAGTTAGGAAAGTCCAATTCTTCATACTCCCTGTCAGATCAGCTTAGCATTAATGCTGTACATCATACACCTGGTGGCAAAAAAGCAACTTTTGATGGAGTGAAGGAACTTCTTGACAAGATCCGTGCTGAGTGGAAAGTCATGTCGGTGGTGGATGTTGTATTGAATCACACTGGTAATCAGTCTCCTTGGCTTTGGCAACATCCAGAATGTGCATACAACCTGGAAAACTCTCCACATCTCAAACCAGCTTTTCTAGTTGATCGTGCTCTTTGGCACTTCTCTTGCCAAGTAGCTGATGGCCTGTGGGAAAGCGAAGGTGTACCTGCCATTGTTAACAACGAACATCATATTCAATGCTTTGGGAACATCTTACGGAACAAAATTTTTCCAAAACTCAGACTTTGGGAATTTTTTTGTGTGGACGTTGAAAAGACCGTAGAACAGTTCCGTCATGCATTGTTGAAGGCCAAAAGACCAGAAAACACTTCAGCTAAACCTGATGGATCTCCACTGGAGGTTCATATGACAGAGTCACATCAACGCTTCTCTGCTAAAATAGACATGGAAAAGGCTCTGAAAAAATTCAACACAGAGAGGTCTGATGCTTTTGACGAAAAAGATAGACTCCATCGCTGTTGTGAAGCTCTTAGGGAACACTTACAAAGTGTCAATGAGGCAATAAAAAACAATGAAGTCGCTTCTCATATCGATTCTGCAGTAAACAGTGTTCAAAATGGTGCAAGATATGAACGTCTTGATGGCAATGGGCCCAGGCATCCAATAGTGTCCAGAACATTTCCTTTGGCAACAACTTACTTCATAACACCTGGTGACTGTGATAGTTTAGAAGATGAGGAAAAACTCATGTTTTCCGACCAAGCCAAGTTTTGCATGGCTCACCAGGGATGGATATTTGGAGGCGATCCACTGAAAGACTTTGCAGCACCAGGATCTTTGGTGTATCTTAGACGTGAACTCATTGCTTGGGGTGATAGTGTGAAACTACGCTACGGAAATGGACCTGAAGATGCTCCTTTCTTGTGGAATTACATGTTGAAATACACTCAGATTTGTGCCAGATTATTTGATGGAATTCGTCTGGACAATTGCCATAGTACTCCACTTCATGTTGCAGAGTACTTTGTTGACGCAGCCAGACAAGTGAAACCAGATTTGTATGTCACTGCTGAATTATTCACAGGCTCTGAAGCCACTGACAACATTTTTGTCAACCGATTAGGAATAACGTCCCTAATAAGAGAGGCACTCAATGCTCACGATCCTCATGAAGAAGGACGTTTGATTTATCGCTATGGAGGTGAACCAGTTGGTGCCTTCATGCACCCATCAGATGTCAAGCCTTTAGTTCCTAGCATTGCTCATGCGCTGTTCATGGATGTCACTCATGATAATCCAAGTCCATTTCAGGTTAGATCAGTCTACGATGCCATGGCTAGTTCAGCGTTGGTTGCAATGGCATGTTGTGCAACTGGCAGCTCAAGAGGATATGACGAACTGGTCCCTCATCATATCCATGTCGTGAAAGAAGATCGTTTGTATCAATCGTGGCTCAATAAATCATCAAAACTCAAAGGCAATGCATTTGTAAAGGACAGCGATGGCATTTTGTCGGCAAAAAGAGCCATTAATGAGCTGCACCGATGGCTGGGTGAACAAGGATATTCACAGGTTTATGTTGATCAAATCCACCATGATGTTCATGCCATCACCAGACACAATCCCGACAAAAGAAAAACAGTTGTTTTAGTGGCACATTCTGCATTCCACAATCCATCAGAAGACGTGCAACCCACAATGGAGAGGCAGAAAGTTCACGTGGATGGGATTCCACCTCTTACAATACCGGGTGAGATAGAGGAGATCATTTTTGAAGCGATGTTACTAAAGAAAGCTAATACAAGCGAATTTGTTCAAGACAAAAAGTACATTAACGGTCTCCAGTCTCACGAGGTGCTTCTTCAAAGACATATCCCATTTCATCAGTCCAAGATATGCCGTGCTGAACGCAAAGGCGATAACACATTTGAGGTTCATTTCCATAACTTTGCTCCTGGTAGTGTTGTTGCGTTTGACATCACAATGGAAAACAGAGTCAAGAATTCATTGGGTCAATTGAGGCAGCTCGCCGTGGATATGTACGGGAAAAAATCTGAGAGCCCCGAGAGTTACAGCAAGATTGATGAATTGGATGCCATTATTGGTAATCTGTCCTTGTGCGATCTCAATCGAGTGCTTTACAGAGCTGATCCCGAAGAGCGAGATGATGGCAATGGGGGAGGGGTGTATGTGTTACCCGAAACTGGTGCATTGGTATACTGTGGCTTGCAAGGTGTTATATCAGTTTTGGCCAATGTTCGTCAGTTTAATGATCTGGGGCATCCATTGTGCAGGAATCTGCGAGATGGGGATTGGTTCATGGATTATACTGTATCCAGACTTCTTCCTTTTGTTGGGACAAGACAGTTGGGAGTTTGGCTGGACAAAGCGTTCGGTTTGGTCAAAGAATTGCCGCGATATTTGGTGCCATGTTACTTTGATGCCATTATTACTCCACTTTACCTCAGGTTGTTGGAGCGTGCCTGGGCGCAAATGTCAAGTACTGTGAAGGAAGGCTCCTCTTTTCTAAAGGCACTGTCACTTGGCTCGCTTCAGTTCGTTGGTTTGTCTACCTCAGCCTCGCTTCCCGTCTTGTCACCCAAACTGTATCACGGGTCGTCATCCGGGGCTTCCATGCCCACACTGATGTCATTGGCTGCAGGTTTGCCTCATTTTTCCACTGGTTTCATGCGCTGTTGGGGACGAGACACCTTCATAGCACTTAGAGGCCTGCTACTGGTCACTGGCCGATACCAGGATGCCAGGAATCACATCTTAGGTTATGCAGCCTGCGTTCGGCACGGTCTGATCCCCAATTTGTTGGACGGCGGACGCAAGCCTCGGTTTAACTGCAGGGACGCAAGTTGGTGGTGGCTCCAATGTGTTCAGGATTATTGCTCCATTGTCCCGAATGGACTCAAGATTCTGTCGGATCCAGTCTCTAGGATCTTCCCATCAGATTCATCTCAACCACAGGCACCAGGAAAGCATGATCAGCCACTGTATGACGTCATTCAAGAAGTGATGCAGCGTCATTTCATGGGCATCAGTTTCCGTGAGCGAGGGGCTGGTCCCGATTTAGACTGTCACATGACCAGTGCCGGTTTCAACGTCACTGCTGGTGTCCGTGAGAATACTGGGTTCGTATTTGGTGGTAACAAGTGGAATGCTGGGACATGGATGGACAAAGTCGGTGAATCACAGAAGGCGGGAAACTTTGGAGTGCCAGCCACGCCGAGGGATGGCTGTGCAGTGGAGATTGTTGGTCTTTGTAAATCCACTGTTCGCTGGTTAGCTTCATTGTGTGAGGAGAAGAAGTTTCCTTATTCAGGAGTATCCAAGCTTGAGGACGAGTTCCCAGTCGAGTTGACGTATCAAGAGTGGGCTTTGAGGATCGACTCAGCGTTTGAAGAGAATTTCTGGATCCCTGAAGAACCAAAACAGAACAATGAAGAGGCAAAGCTGGTCCACAGACGGTGTATCTACAAAGACACTCTGGGAGCAAGTCACAGATTTGCTGATTACCAGTTGAGACCCAACATATGTGTTGCCATGACTGTGGCTCCAGAGATGTTTGTTCCGGAGCATGCGTGGAAGGCCCTCGATATGGTAGAGAAGGTTCTCGTGGGTCCCCTGGGTGTCGCTACTCTTGATTCCAGTGACTGGGCTTATGAGGGAGTGTACGACAACTCACAAGAATCCAGTTCCTACAAAAGCGCCAAAGGATTTTCTTACCATCAAGGACCGGAATGGCTGTGGTGCCTAGGCCCCTTTCTTAGAGCTCGGTTATACTTCTCGAAGAAACTTTACGGCAGAGAGGGACTGGAAGAGACCGTAGTTCGTGTCAAGAAGATTCTAGCCAGGCACAAGACGGAGATCACATCTTCGCCATGGCGCAGCTTGCCAGAGCTTACAAATGCAGGAGGGTCACCCTGTTATGATGGGTGTCCTGCACAGGCTTGGTCTGTGGCCTGCCTAATTGACGTATTGTACGACATGGAAGCATTGCTGAAAGCTGATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q2PQH8	Glycogen debranching enzyme OS=Canis lupus familiaris OX=9615 GN=AGL PE=2 SV=1
P35574	Glycogen debranching enzyme OS=Oryctolagus cuniculus OX=9986 GN=AGL PE=1 SV=1
P35573	Glycogen debranching enzyme OS=Homo sapiens OX=9606 GN=AGL PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003615 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14699 all species →	hGDE_N	N-terminal domain from the human glycogen debranching enzyme	Family	Interproscan
PF14701 all species →	hDGE_amylase	Glycogen debranching enzyme, glucanotransferase domain	Domain	Interproscan
PF14702 all species →	hGDE_central	Central domain of human glycogen debranching enzyme	Domain	Interproscan
PF06202 all species →	GDE_C	Amylo-alpha-1,6-glucosidase	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029436 all species →	Domain	Eukaryotic glycogen debranching enzyme, N-terminal domain	Interproscan
IPR008928 all species →	Homologous_superfamily	Six-hairpin glycosidase superfamily	Interproscan
IPR032792 all species →	Domain	Glycogen debranching enzyme, glucanotransferase domain	Interproscan
IPR012341 all species →	Homologous_superfamily	Six-hairpin glycosidase-like superfamily	Interproscan
IPR010401 all species →	Family	Glycogen debranching enzyme	Interproscan
IPR032788 all species →	Domain	Glycogen debranching enzyme, central domain	Interproscan
IPR032790 all species →	Domain	Glycogen debranching enzyme, C-terminal	Interproscan
IPR006421 all species →	Family	Glycogen debranching enzyme, metazoa	Interproscan
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10569 all species →	GLYCOGEN DEBRANCHING ENZYME	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0004134 all species →	Molecular Function	4-alpha-glucanotransferase activity	Interproscan
GO:0004135 all species →	Molecular Function	amylo-alpha-1,6-glucosidase activity	Interproscan
GO:0005980 all species →	Biological Process	glycogen catabolic process	Interproscan
GO:0005978 all species →	Biological Process	glycogen biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01196	AGL; glycogen debranching enzyme	EC:2.4.1.25 EC:3.2.1.33	Starch and sucrose metabolism	ko00500	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074612303.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

74TPM > 0

2Conditions

36.6Max TPM

19.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	19.17	36.13
all_coral_tissue · baseline	38	34	20.85	36.61

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.13
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.72
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.97
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.15
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.72
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.71
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.20
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.46
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.96
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.79
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.60
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.53
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.45
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.35
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.06
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.70
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.76
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.58
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.36
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.83
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.73
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.53
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.43
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.32
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.21
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.17
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.56
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.48
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.50
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.41
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.42
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.49
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.03
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.17
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.49
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.80
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.20
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.94
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.06
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.94
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.61
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.25
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.55
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.93
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.86
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.34
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.68
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.69
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.08
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.51
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.32
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.30
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.94
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.90
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.90
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.83
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.62
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.42
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.33
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.77
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.78
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.72
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.63
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.46
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.84
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.87
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.52
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.44
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.09
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.86
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.96
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.49
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.55
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.20
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.