Gene detail

Detailed information of XP_074612911.1 in Acropora palmata

Genomic Location: NC_133882.1:29962912...29987258
NR annotation: XP_029213274.2, ubiquitin carboxyl-terminal hydrolase 20-like isoform X2 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074612911.1

ATGCCAGCTTGCCCTCATTTAGTTTCCGTGGAAGAAATTAATGCGGAGGAGATCAGGAGGAAAATGACAGAAGAGCACTGTAATCGTTGTGAAAAGTCTGGGTCAGACCTCTGGGTTTGCTTGCAGAGATGTTGTTCCTTTGTTGGATGTGGACGATTTGGAAATAATCACATTGAGCTTCACAGTCAGGAAGAGAATCATACGTTATGTTTGCACTTACATGACTTCCGCATGTGGTGCTTCAGCTGCCAGGGAGAGGTGTCACAGCCATCTGATGTATCAGGGGCAGTTAATGGTGATATGGACAGGCCTAAGGCTCATGAAGTTCTGGATATGGAGGATGCCATTGAGTTAGAAAAAGGTTTAAAACCAAGAGGGCTGTGTGGTCTGGCAAATATTGGAAATACATGCTACATGAATGCTGCGCTACAGGCTTTGTCGAACTGTCCACCACTCACACAATACTTCCTGGAGTGCAGCAGTTTTTCAAAGGAAGTTAAGAACACTGCAGTCTGCAAAAACTACTCTCTTCTAATCAATGACATCTGGTCACGGAAAAGACCAAAGTATGTCGTCCCTTCTCAACTCTTGCGAAGTGTGCGTTTGGTTAATTTACAATTCAGAGGATATGGACAGCAGGATGCACAGGAATTCTTACGTTGTATCATGGATCAGCTTCATGAAGAGTTGAAACGGCCAGTGCCATCACTCACAGTGGACCCAGTGTCATGTGGCAGTGATGATGATAATGATGACCGAAATCATCAAAACAAGAGGCTTTTAGGAGGAGACAATGATGTGGACATGTACTCAGATAGTGGTGACGATAGTGCAGATGGCAAACCACTTAATGTGGACACAAGTGAAGAACAAGTGGACAGAAAGTGGGACAAGAAGGCTAAACAAATGACAGCCAATGTTAATAGCGTTGACCCCGAGGATGTGTCAGTATCAGTTGAAGACGAACCAATGAGTGATGCTCAAAGTGAGCATAATGATCAGTGTTATGAGGTGATGGATGCCGATGACAGGGCATTAATTAAGGAAGAGAAACCTGTTGGTCAAACTGCTAACGAAAAAGGAAATCACTCACTGCCTCTAGAACAACCTCCTAAATTGCCCAAAGTGACAGAATCAAGTAAAAAGAAAGAACCTGTCATCTACAGCAGTATAGTGACAGACTTGTTTGATGGAACAATACAGAGCTCTGTTCAATGCCTAACTTGCCACAGGGTTTCTTCAAGAGCAGAAACATTCCAAGATGTTTCTCTTCCAATTCCAGGAAAGGATGAATTGACAGTTCTTCATTCTTCTCAATGCTCTCCACTGACATCATGCTCCTCTTTGATGGACAGAAGTCAGGAAAAAAGCTGGTTGACAACAATAATTCATTGGCTTAAAAGCATTAGCAACATGTACCGGTGGTTTGTAGGTCCTCAAGTTACACTTCATGACTGCCTTTCAGCGTTTTTTTCAGCAGATGAACTCAAAGGGGATAACATGTACAGCTGTGAAAAATGTAAAAAGCTTAGAAATGGTGTCAAGCTTTGCAAAGTAATGCATCTTCCTGAGATCTTGTGTATTCATCTGAAGCGTTTTAAACATGAAATGTACTTTTCTTCCAAAATCAATTATTTTATTTCATTTCCGCTCACTGGATTGGACATGAAGCACTTTGTGGTAAAAGATTTTACCAAGTTGGATCCAAATTACAGTTGTACAACTTATGATCTTGTTGCTGTTATAACACATCATGGAAGTGTTGGAGCTGGCCATTATGTTAGCTTTGCCAAGAACTATATTAATGGAAAGTGGTATGAGTTTAATGACTCATGGGTCAGTGAAGTGCCTGACTCCTATGTATTAAATGTGGAAGCCTATGTATTATTTTACAGGAAATCAAGTGAAGAGGCTACCAAAGAGCGTCAGATGGTTTATAATTTGTTTAAAGAGTCACAGCCCAATGAGTCAAGGTATTTTGTCTCCAAGAAATGGCTCACAAAGTTCCAGTCTTGTATGGAGCCAGGTCCTATTACCAACTCGGACTTCCTTTGCCCTCATGGGGGTGTTAATCCATTGAATATTGAAAGAATTCAAGACATAACAACTCCTCTACCTGAATCCGTCTGGAGTCATTTACTTGCCAGGTTTGGAGGTGGCCCCCAAGCAAAATCACTGAACGTGTGCAGACATTGTAAGCGAGCTCAAGATGAACTTGAAAGGAAGAGAGAAACAGAAATGGAAACATTTAAAAGGTTGAACCATGATTACCCAGCCAATGAGAATGTAGACACATATTGCATCAGTATGCGATGGTTTAGACAGTGGGAAATGTTTGTCAAGGGACAAGAGCAAGACCCTCCTGGCCCTATTGATAACAGTAACATTTTATTTATGAAAGGGAACACTAGAGTATTGCGATCCAATTCTGAGCATGGACAGCTTTCACAGGAAACCTGGAGATTTCTGTATGATATTTATGGTGGAGGGCCTGTGTTTTGCATGGAGGGAAAGAAAGAAGTTGAAGAAAAGCAAGATCAAAAGGAACAAGATGAACAGCTCCAGCAGGGTCAAAGTCATTATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A7Z056	Ubiquitin carboxyl-terminal hydrolase 20 OS=Bos taurus OX=9913 GN=USP20 PE=2 SV=1
A0JM59	Ubiquitin carboxyl-terminal hydrolase 20 OS=Xenopus tropicalis OX=8364 GN=usp20 PE=2 SV=1
Q9Y2K6	Ubiquitin carboxyl-terminal hydrolase 20 OS=Homo sapiens OX=9606 GN=USP20 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003770 (this species only)
Ubiquitin family	UBD\|ZnF\|ZnF_UBP · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06337 all species →	DUSP	DUSP domain	Domain	Interproscan
PF02148 all species →	zf-UBP	Zn-finger in ubiquitin-hydrolases and other protein	Domain	Interproscan
PF00443 all species →	UCH	Ubiquitin carboxyl-terminal hydrolase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006615 all species →	Domain	Peptidase C19, ubiquitin-specific peptidase, DUSP domain	Interproscan
IPR018200 all species →	Conserved_site	Ubiquitin specific protease, conserved site	Interproscan
IPR035927 all species →	Homologous_superfamily	DUSP-like superfamily	Interproscan
IPR001607 all species →	Domain	Zinc finger, UBP-type	Interproscan
IPR028889 all species →	Domain	Ubiquitin specific protease domain	Interproscan
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR050185 all species →	Family	Ubiquitin carboxyl-terminal hydrolase	Interproscan
IPR001394 all species →	Domain	Peptidase C19, ubiquitin carboxyl-terminal hydrolase	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21646 all species →	UBIQUITIN CARBOXYL-TERMINAL HYDROLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004843 all species →	Molecular Function	cysteine-type deubiquitinase activity	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0016579 all species →	Biological Process	protein deubiquitination	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11848	USP20_33; ubiquitin carboxyl-terminal hydrolase 20/33	EC:3.4.19.12	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074612911.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

68TPM > 0

2Conditions

60.9Max TPM

22.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	36	20.78	60.92
all_coral_tissue · baseline	38	32	24.54	44.28

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.92
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.88
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.55
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.56
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.49
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.94
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.20
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.08
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.02
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.88
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.69
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.46
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.40
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.46
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.10
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.70
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.19
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.82
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.78
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.67
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.15
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.24
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.31
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.28
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.03
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.03
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.02
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.99
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.87
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.43
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.92
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.18
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.91
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.75
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.42
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.48
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.28
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.78
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.91
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.65
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.33
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.09
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.85
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.76
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.59
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.11
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.73
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.43
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.67
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.17
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.00
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.21
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.34
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.94
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.11
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.99
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.24
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.42
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.28
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.60
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.09
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.75
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.95
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.24
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.07
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.60
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.11
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.23
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.