Gene detail

Detailed information of XP_074614271.1 in Acropora palmata

Genomic Location: NC_133883.1:2533331...2547442
NR annotation: XP_044173346.1, uncharacterized protein LOC114958440 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074614271.1

ATGGCTGTTTTCTTCAAATCATACTTACATCAGGGATCCATTGATTTAAGCAACGCGGTAGATGAGTCATCAACGCCTGTATTCCAGCGCCTTGCGTTCGGAGTTGGTCACATACTCAATGACCTCGTTGTTCAGCTTCTCTTCTCGTTTCGCCTTGTTTTCTTTATGAATGTGCTCGGTCTCTCCGCTGAAAATAGCGGCTGGCTTGTTCTTCAAAAACAGATGGTACACACCGTCATGGCGCCCCTTTGCGCCATATTAGTGGACAGAGTCCACATACCACCGGCGTCCAGGAAGCTTGGAAAGAAAAAGACTTGGCATTTGCTTGGAGCTATCTTGCAAGCAGTCTTCGTCCCCTTTTTATTCGCTGCTAACTACCTCATTCGAAGTGAGGATGGCAAGACAGAGCAGATGATGATGATATACTTCGGAATTTTAAACGTTATTTTAGCTTTTGGCGACATCATATTAGATATCTCCCATTTGTCTCTAATTTCAATGGTTTCGAAAGATCAAATGGAAGCAGTGGAATTGAGCGCATTGAGGTCCGCCTTTTCCTACTTGAGTGGTATTTTAACCTTTGTTGTAGCTTGGATAACCTTTGGGCAAGATTCAGAAAGTCAAATATCTGAAGACAGTTCCAAAGATTTCATGATATTGACAGCAATTTTGGTGACAGTGGGCTTTCTGTTCGCCGTGATATTTCAAGTTGGGGTCAAGGAGCCTAGTTCGAGTTCCCGTATGCCTTTGAGGAAATTGTCGACTTTCGCAGCAGCAAATTTGATGAGGCCGACGTCTTTTACTCCCTCGGTTGGTCTTGAAGAACCAATGCCTACTCTTGCAACAGCAGGACTTACTGTTGCCAGGAAGTTAAGTCGTTCTTTACGGAAAGCATCTCGAGTTAGTTTCTGCGATGCGACCCGATGGTCACCGACAAAATGTGATGAGAACGAGGAGAAGGTAGACATTCTCCAGTCTTCATCTTTATTGAACAATCCTAAATCCACTGGCGAAGTCAATAAAGGGTTTTATGTCAGTGTACTGGATCTGTATTCAGATGATACATCAGATGGCACAAGCCACATTGGAAAAGAAACAGCACCCACCAAAGTATCAGCTCTTTCAGTTTCAGCTGTGGAAACTGAAAATGTGCTTTTATCCGAGACAAACAGTCAACCTGTTAGTAACTCAGGATTAAATACTGAAAGGAAGGAGAGTTTTCATGCAAAGAAAAAGTCTCGTGTTTCTTTCGAAGATAAGATCCAATGCAGGCTGGAAAAATGCGATGCGAACGAAGGGCGAACACTGTTAAAGGAGAAGGAACCCCCAAAAGTAAATCACCAGTCTTCGAGTTCATCGTCTTTAGACGACCATAATTCGGCCACGAGCGTTGTAGCTGAACGCCGTTCTGTCAGTGTATTGGATTTGTATTCAGATGATGAATCGAACAACACAAGCTGCGTTGGCAAAGATCCCGCATCCAACAATGTATCAGCTGTTATCTTGGAAAATAAAAGTGCTCCTTTATCCGAGACTGAGGCAAACGGAGCAAATGCTACCGAGAAAGAGAACCGTCCTTCAAGACGGAGGGCTGGTGTTAGTTTCTCCGATAGTATCCTTGGAACGTTGACAAAATGTGACTCAAACAAGGAGCAAACGTTGTTCAACGAGAAGGATGCTACAAAAGACCATCTCCAGTCTTGGAGTACATCACCATTATCATCAGACCACCCTAACTGCCCAGACGTGGTCCATAGGTTAAATAGTGAATCACATGACACAAGCAGTGTTTGTAGAGACCCAGCAACTGTCAACGTTTCAGCTGTTTCACTAGAAATTGAGGGTGCTTCTTTACCCGAGAACAATTCAAACAACCAGCAAGTTATTAATTCAGATGACAATCAAGCTGCGCCTTCCCGATCACACAGAGCAAAAAAGACTATGCGAAGCTGGCTTATCGACCCTCGTCTATACATAGTATCCTTCGCTTATTCCTGCCCATTGGCATTGCAAACACAGGCCTATTCGTATCTACCACTCCTTCTTATTTACAGACTTCGTTTAAGCAAGGAATCCATCGCTTATCTGCCTCTCATTATGTCGATAAGTGCTACAATGTCCTCAATATTTTCAAAGAAGCTTGTTCAAAAAATAGGAAGCAAGCTATGTTTCATCTTTGGTGCTATTTTTGTATGCTCTGCCGGAGTTATGTCTTATTTCATGGAACCTGAATTCAGCAAAGTGATGGTTTATCCAACTGTGATATTACTTGGATTCGGTTTTTCCTCGATGCTTGTTAATTCCCTCAGCTTTGCAACCGAACTTATTGGCGAAAATAAGGGAACAAGTGGTTTTGTATTTGGCTGTATGAACTTGATCTCATATGTAGTTGTCGGACCCTTATTCCTAATCATACAAAAATTTTTCCCGGAACAAAGGGGCACAGACTGTGAAGAATGTGGAGGTTATTTGCGGCTTGTGTTTTCGTTGGTAGCTTTCGTCTTCTCCACTTTTGGGGCGTTTCTTGTGTTGTCACTTTATTGCATGGATCGATTTCAAGGAAAAAGTTCTTCAACCAGTGAAGATTCAGAAACTTCCAAATGA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001099 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07690 all species →	MFS_1	Major Facilitator Superfamily	Family	Interproscan
PF13347 all species →	MFS_2	MFS/sugar transport protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011701 all species →	Family	Major facilitator superfamily	Interproscan
IPR036259 all species →	Homologous_superfamily	MFS transporter superfamily	Interproscan
IPR039672 all species →	Family	Lactose permease-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11328 all species →	MAJOR FACILITATOR SUPERFAMILY DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0022857 all species →	Molecular Function	transmembrane transporter activity	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0005215 all species →	Molecular Function	transporter activity	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0008643 all species →	Biological Process	carbohydrate transport	Interproscan
GO:0015293 all species →	Molecular Function	symporter activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0071702 all species →	Biological Process	obsolete organic substance transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074614271.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074614271.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

76TPM > 0

2Conditions

98.0Max TPM

31.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	24.22	83.39
all_coral_tissue · baseline	38	36	40.31	97.96

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	83.39
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	74.28
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	71.18
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.38
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.39
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.07
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.04
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.44
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.22
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.16
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.45
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.03
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.58
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.21
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.14
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.60
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.85
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.32
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.47
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.70
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.31
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.56
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.69
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.39
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.21
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.85
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.49
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.33
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.97
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.72
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.67
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.87
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.87
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.27
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.93
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.53
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.15
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.05
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.41
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.97
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	97.96
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	78.17
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.50
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.76
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.15
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	68.87
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.58
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	59.13
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.98
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.49
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.72
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.44
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.53
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.78
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.44
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.40
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.05
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.46
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.29
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.94
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.45
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.57
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.90
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.39
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.03
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.21
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.57
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.83
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.98
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.85
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.69
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.57
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.04
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.66
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.34
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.18
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.