Gene detail

Detailed information of XP_074614575.1 in Acropora palmata

Genomic Location: NC_133883.1:10804371...10826167
NR annotation: XP_015770964.1, PREDICTED: uncharacterized protein LOC107349337 isoform X1 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074614575.1

ATGGCGGAGCCAAGAGCCTGCATGTTGTTAACGGTTTTCCTTTTCTTTGTCATTGATCATGAAGGAGTTGTGTTGTCTACTGCCAGTGATGATTTACGGGCAGAGTTCAACATGGGTGGAATAAAGGGAAGCGTTGTCTTCTCGCAGCCACAAACTGACGGTGCTACAACCATCTCAGTGAATCTCTTGGGCGTCAATGAGACTCTGAAATGGAGCATTCGACAACTACCAATGATCTACGATGGAAATGCAGCCCTCAGCTGTTCTGCTAGTGCAATAGGCGAGCTCTTTGACCCAAAGATGGCAAAAATGGCTGCCAATTACGATTCCCGATGTCAAAATGATAATAACACAAAATTCCATGCGTGTGCTGTTGGAGACCTGAGTATAATGCTGGGAAACATCACAGCAGACACAGCAAAGATGAACCACACCAATCAGAACTTGATAATTCCAACCAGAGGGAAAAACAGCATTATGGGTAGAACCCTAGTCCTTCACAGCGGAGCTGCACCCAAGGCATGTGCACTGATTACTCCTGCACACCAAATGAAAACAGCGGTAGCAGTGTTTAGAGCTCCAATAGCAGGCTTTGTTTACTTGAGGCAAGTTGAGGACATGCAGGACACCACTATCTTTGTGGATCTCTTCTTTGTTAACAATGCTGACTCTCAGGGAGACTTTACATGGCGGATAAACCAAGGATTATTGGACACTGATGCATCTGATTCCACAACTTACTGCAAAACACTCGGTGAACTTTTCAACCCAGTCAACAGTCACAGTCAAAACTGTAGTCAAGAAATGCATAGAAATTGCCCAGTCGGTGATCTGGCATCGAAACATGGAAATGTCACCGTTTCCGTGGCATCTGCGCGGCAATCGACAACCAAAGCGGCTTTCACAGACTCTAACTTGCCATTGAGTGGTGCCAATTCAGTCATTGGCCAATCGATAGTTTTGTTTCCTGTGAATGATCCAAGGAAACCAATTGCCTGCGCAAAGATCGTGACTCTTATAACTCAGGTAACGAAAGCTAATTTCATGGCTGATGTCAATGATGGAGTGAGCGGGTATTTCAGGTTTACTCAAAGGTCACCCTTTGATCCCACTTTGGCTGAAATTTCCGTAAGAGGCTTGCAGAACATAGCTGGAGGATATCATGTGCACGTCTATCCAAGCCCATACTACAAGACTCACTTGACAGCAAGTGATTCCTGCCAGGGTTTTGTTGCTGGAAATCACTGGAATCCTTTTGATGTCGATATTAAAGAAAGTCCTGCGAATGCAACAGGAACGGACGATGAATATGAAGTGGGCGACTTGAGTGGGAAATATGGTTCATTCCTAAACCTCTCAGTTGTTACGAAAAGCATCGTCGATTACAATCTCCCCATGTTCGGCCGAAACAGTATCCAAGGCCGTTCCATTCTTATTCACAAGAAAGAAAAAAACGCTCGATGGGTCTGTAGTAACCTCAAGCCATTAGTTGATGCTGGTACCACTTTTGTTATGAGAGCCACCGCAAATTTTACTGGACCATCTCTCAACGGAATGATCGTAATGGACCAGCACATCTCCAGTGAAGAAAATATGGCGTCCCCAGAGAGTTCAATTTTTATCGAGGTGAATTACCCTGACCCCAATGCATCAGTATCGGAGAATCATAAGTGGCAAATAGATCTGAATCCTGTAAACGATGATGCAACTGCTGATATCAACAAGAGATGTGCAAGTTTGAAGAACGACTTCAACCCTTACGAAGTGTTTGTCGAAGGAACTTATTCTTCAACTTGCCGCCCAACGAACATGCTCCGCTGTGAAACAGGAGACCTTACCAAGAAACACGCCTCTGTTAAGGTGAATGGCGGTCGCCAGTTCTACAATGATATCAATCTTCCCCTGTTTGGTAGAAACTCAGTCATTGGCCGTGGAATATCAATATACGAGAAAGATATGGGACAGAATCGTCTTGCCTGTGCAAATATCAAGCCCTTCTCGACCTTGTTTATGGAAAGTTCTTTGGAATTTGTTAAACAAGATCCATTTTCAAGTTACCATTTTGTCGACGTTGTGTCCAAAGCGCTTGGAATTCCAAAATGGCGGTTGTTCAATATTCGTATCGACAAGGCTGAGGTTGATAAATGCCAAGTAGTCAAGTTTGGAATCATTGGCAAAGTGGACCAGGTTGCTGAAGTAAGAACGGTATTTCAAGGCACTTTGAAAAGCAACCCAGATGCCTTTGGACAGTACAAGCCAAGCAACGCTTGTGTGCCCAGCTCGGGAGGAGCGCGTGGATGCTTCCCCGCTATTTTTGGTTTGGCGATCGCTGCAATGATGGCGAAAATTTTCATAGTTTTGTTTTACATGTAA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001583 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00080 all species →	Sod_Cu	Copper/zinc superoxide dismutase (SODC)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036423 all species →	Homologous_superfamily	Superoxide dismutase-like, copper/zinc binding domain superfamily	Interproscan
IPR001424 all species →	Domain	Superoxide dismutase, copper/zinc binding domain	Interproscan
IPR053257 all species →	Family	Cu-only superoxide dismutase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR20910 all species →	AGAP001623-PA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006801 all species →	Biological Process	superoxide metabolic process	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074614575.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074614575.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

84TPM > 0

2Conditions

684.1Max TPM

288.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	46	227.57	684.07
all_coral_tissue · baseline	38	38	361.77	603.67

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	684.07
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	498.29
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	483.89
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	464.37
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	410.43
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	387.79
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	380.24
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	372.87
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	366.19
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	280.03
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	275.16
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	263.16
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	255.07
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	238.73
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	219.49
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	217.70
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	217.14
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	215.14
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	213.77
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	205.95
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	200.53
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	200.36
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	199.56
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	187.89
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	184.36
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	178.32
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	173.52
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	171.05
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	170.11
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	167.42
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	166.80
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	161.03
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	159.95
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	152.74
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	143.03
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	140.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	138.34
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	121.90
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	120.52
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	116.46
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	114.60
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	103.38
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	96.43
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	90.32
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	82.28
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	78.01
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	603.67
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	595.82
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	530.65
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	526.86
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	510.52
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	505.46
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	485.57
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	477.31
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	466.10
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	451.53
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	422.43
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	403.14
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	383.41
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	374.38
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	373.57
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	371.14
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	367.59
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	353.61
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	353.26
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	342.54
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	333.67
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	322.61
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	320.55
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	319.06
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	310.96
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	297.07
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	295.89
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	294.88
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	281.10
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	268.33
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	265.64
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	258.57
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	252.52
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	252.12
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	216.23
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	215.53
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	206.96
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	137.05

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.