Gene detail

Detailed information of XP_074614728.1 in Acropora palmata

Genomic Location: NC_133883.1:9116182...9121972
NR annotation: XP_029200845.2, putative N-acetylated-alpha-linked acidic dipeptidase [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074614728.1

ATGAGCAAAATAACTGAAAAAATTGCAGACAAATATGAGTTCATGGCCGAAGAATCCAATTCATTGGGAGGAGTAAGACCAGTTCAACGCAAAAACAGAAGATCCTTGTTGATCGTACTTGGTTGTCTCCTTGGTGCAGCTGCCCTATTTTCAATCGGATTCTTGGCTGGCTATTTTACTCGAACATCGAAGGAACATGAAAAAAGCTGCGACACTAACAACCTAGGAATCGATGACACTGATAACAAAATCAACTTCGAAGACTTTCATGAAATCTTTCAACAGTCAGTTAGCGTGGGGAATTTGGAGACTGTCATGAGGGAATTTTCTTCACAGCCTCATATTGCTGGAGGCCCAAGGCAGCTCGATCTTGCCAATAAATTGACCGCACTTTGGACCAAGTTTGGGTTTGACAAAGTGGAGAAACCGGAGTACAGAGTGCTGTTATCGTATCCAACACACAACAAACCTAACAGAGTAACTCTTGTGGATAATGGGGAAGCCATATACAACATAACGGGAAAAATAAAAATTTCTCCGGGACCAAACAGCAATGACACTTTCGATCATTATCCCTACCTGGCTTATGCGCCCAGTGGGACAGTGGAAGCAGACCTGATCTACGCTAACTTTGGACGAGATCAGGACTTCCAGAAGCTCGCAGAAATGAACGTCACTGTGCGGGGAAACATTGTCATCATTCGCTCAAGAAACGTTAGGAATGCAGAGAAACACGGTGCAGCAGGGGCTTTAGTTTACGCCGACCCAAGCTTCTCCGCGCAGAAAGGATACAGAAGTGATCAAGTATACCCTAATGGTTGGTGGCTACCTTCGGATGGGGTGCAAGAGGGAAGTATTTTGTTCGGTCCCTACAATGGAGACCCATTGACTCCGGTACTTCCGGCGACAAAGGGAATGTTCCGGAGACCAGCAAATGAAAGCGAGCTGCCAAGAATTCCAGCACAGGCAATATCGTATGGCGATGCGATGGAACTACTACAAAGACTTGGAGGAGAAGAAGCTCCAGAATCTTGGCAGGGAGGATTAACCATAACGTATCATGTCGGTCCTGGATTTAAAAACAGCAGCATCAGAATCAAATTGGAGGTCAACAATCAACTACAAGAGAAAAGCATATACAACGTTGTCGGCACCATCGTGGGCAGAGACGAACCTCATCGGTATATCCTCGTAGGTAATCATCGGGACTCTTGGTCTTTTGGTGCAGTTGACGCTCTGAGTGGAACTACAGTGACCAATGAAATTGCCCGTCTTCTTGGTATGCTGTTGGAGAAAGGATGGAGACCTCGAAGAACAATAAAAATTTGCAGCTGGGGCGGTGAAGAGTTTAACTTGATCGGATCGCACGAGTGGGTCGAGGAAAACGCACACATTCTCACAGAGCGCGCTGTGGCTTACATTAATCTGGACATCGCAGTGTGTGGTGATTACGTGTTAAGGGCAAGAACAAGTCCTCTTTTCAAACAGGTTACTTACAAATGGGCAAGACAGGTAAAGAACCCCCAACATTTAGAGGCAAATGACACAATGTACGACATTTGGCTCAAGAGAACTCCGTCTGACATCAATAATAGTGAGCCCATGATATTCAATCTTTTCTCTTCAAGTGATTATGCTTCTTTTTACCAGTACTTGGGAATTCCCTCTGCAGATTTTGGCTATTGGTTTGGATATGGTTCTACAACGTCCTTGTACCCAGTTTATCACACTCAACAAGATACATTTTATTGGGTAAAGAAATTTGTTGATCAGAAATTTCAGGTACACAAAGCGATGACACAATTTAGTGGCGGAATGCTATTAGATCTCGCAGACCAACCTCTTCTGCCATTTGATATAATGAACTACGCGAAGGCGTTGAAATATTCCTTCCAAGTTCTTAACACTTCTTCTCATTTCTCAGTCAATAACATATCCCTGTCGGCACTACAAGACGCTATCACTGGTTTTCTTAACACCAGCAAACGATTCGAATCTAAAAAGTCTGATCCAACGGAACATAAAAGCACATCAAGACTGCGCATGCTCAATGACCAAATGGTGAACGTGGAAAAGGCGTTTATTTACCCATACGGTCTACCGGGTAAAATCCAAAGTCGTCACGTGGCATTCAATTATGGTTTTCATAATCTGAAGCCTGGCAAAGCGACGTTTCCAGGCGTTACAGAGGCATTACACATGGCTGAGATATCTAATGACTGGAATACTGCGAGGAAACAAGTGTCAATAGCTATTTACAGTGTACAAAGTGCCAATCAGGTGCTAAAAGAGCCTATGAAGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P70627	Glutamate carboxypeptidase 2 OS=Rattus norvegicus OX=10116 GN=Folh1 PE=1 SV=1
Q9CZR2	N-acetylated-alpha-linked acidic dipeptidase 2 OS=Mus musculus OX=10090 GN=Naalad2 PE=1 SV=2
Q9Y3Q0	N-acetylated-alpha-linked acidic dipeptidase 2 OS=Homo sapiens OX=9606 GN=NAALAD2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000217 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04389 all species →	Peptidase_M28	Peptidase family M28	Family	Interproscan
PF04253 all species →	TFR_dimer	Transferrin receptor-like dimerisation domain	Domain	Interproscan
PF02225 all species →	PA	PA domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036757 all species →	Homologous_superfamily	Transferrin receptor-like, dimerisation domain superfamily	Interproscan
IPR007484 all species →	Domain	Peptidase M28	Interproscan
IPR007365 all species →	Domain	Transferrin receptor-like, dimerisation domain	Interproscan
IPR046450 all species →	Homologous_superfamily	PA domain superfamily	Interproscan
IPR039373 all species →	Family	Transferrin receptor protein 1/Glutamate carboxypeptidase 2-like	Interproscan
IPR003137 all species →	Domain	PA domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10404 all species →	N-ACETYLATED-ALPHA-LINKED ACIDIC DIPEPTIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004180 all species →	Molecular Function	carboxypeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074614728.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074614728.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

55TPM > 0

2Conditions

31.8Max TPM

6.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	28	3.99	19.72
all_coral_tissue · baseline	38	27	9.94	31.78

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.72
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.70
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.33
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.79
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.04
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.49
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.52
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.52
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.96
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.84
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.53
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.49
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.30
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.44
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.04
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.40
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.20
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.09
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.08
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.97
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.42
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.10
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.04
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.92
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.78
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.01
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.78
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.25
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.78
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.87
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.45
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.81
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.30
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.70
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.78
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.43
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.93
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.91
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.70
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.79
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.59
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.54
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.50
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.69
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.69
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.59
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.32
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.17
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.39
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.02
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.20
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.52
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.57
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.20
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.39
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.