Gene detail

Detailed information of XP_074614820.1 in Acropora palmata

Genomic Location: NC_133883.1:25195833...25203997
NR annotation: XP_029191536.1, ubiquitin thioesterase Zranb1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074614820.1

ATGCCAAAGAAAGAAGAAAGTTTAAAGTGGGCCTGCGAGTACTGCACATATCTAAACTGGCCGTGCTCCGAAAAATGTACTTTGTGCTGCGCTCCGAGGCCACCTCAAGTTATAACTCAAGAATCTAGGAGACCGACAATTGTAAGCGAAGATATTTATGAGGCGGCTAGTTGCGACCGGATTATATCGAAAGATCCTCTCATTTGCTCGTCAAAGGAGAAAAATACCCAATCGGCACAATTACCGGAGCAGATTGAGGACTACGTGAAATGGACCTGTTCTTCTTGTACATACGAAAACTGGCCTCGCTCGCTTTATTGTTCGATGTGTCGCACTTCGAAACTCAAATCCGGTAAGAATGCAAAGCAATTAGAACCAGGAAGCGGTAATAAAGATGCTTCCTCTCGAAGTGGCTCTCCAAGATCGCCCAGTCTTGTTGGTGGTAACGGAAGGCTCGACTCGAAAACAATAAATAATGACAAAAACAGAGCGCTTCTGAGGAGTAATTTAAAGTGGATTTGCCCACAATGTACTTACGAAAACTGGCCGAAAACGCTGAAATGTGCTCTTTGTAAGTGCTTGAAACCACCCAAAACAAAATACGATGAAATAGCAAAAAACTCTACTTCAGACAACAACGTTAACACGAAGAGGCCATCGACGTCAAAGAGAAGGTCCCCAAACTCATCCGTTAGTGAATCCGCTTTAGGAATTCAACCGACTCATCCGGTAGGAGAACAGATTATTTACGACATCCCGGCTTCAGATGATATTAATGATAATGAGGAGGTGATGCAAATCCGTAATCGCCTCAAGGATTCAGATTGGTTGTGGCTGAGCGCTTGTATAGGTGTAGTGGAAGGTGAAACATCGTCTGTTAATGGATACCTTAATGCTGGAGGTGATTTGTCGAGGCAGCTGACAAGGGAAGACTGTATAGTTTTGAACCGTCCAGGAGTGTTTGAAGTTGGCCACACTCTCGTTCACTTGGCTTTTAAATTTAAGAGAGATGAACTTATCACAGTTTTACTCACCCCTGAAGTTACCGGTCATCATTTACACCGTGTGCCATGTATTGCATGCCCTGAATTGGCAGCAGATATTAGGAAACAAATGGGACATACAATTAGGCAGCGGAAAGGAGACTGGCGCTGTTACTTTTTCACTGACCAAGTTACTTTTGTTTTGCCAGCTGAAATCCAAGACTTTCCTGCTAGAGTGCAAAGACAAGTGTTTGATGATATTCTTGATAGAGAAGTTCAAAGAGTTTTAGAAATTGAATCTCAGGTGATCAACTGGAGTGAAGAAATCACAGAACAATTAGGAAGTAGGATTTATCCTCTGTGGAATCGTTCTGCTGGCGACTGTCTTTTAGATTCAATCCTTCAAGCTTCGTATGGAGTGTTTGACAGAGATAACACGTTGAGAAGAGCCCTGTATGACAGTCTAACTGAGGGAGGTTCTCGATTTTTTAACCGATACAAAGAGTGGGAATCCATGCAGGCAGAAACCTTGCAGTATTCTCTAGATGAAGATCAGTGGGAGCAAGACTGGGCTTCTATTCTTAGTCTGGCTGGTCAGCCTGGGACGTCTTTGGAGCAAACCCATGTGTTTGCATTGGCTCACATTCTGCGCAGACCTGTCATCATTTATGGTGTGAAATATGTCAAGAGTTTCAGGGGAGAAGTGCTTGGTCTTGCTCGCTTTCAGGGGGTTTATCTTCCAGTTTTATGGGAACAAAGTTTCTGTTGGAAGAATCCGTTGGTCCTGGGGTACACAAGAGGCCACTTTTCCGCTTTGGTTGCTATGGAAAGTGATAACTCCAATGAGCTTGGTGCAGGAGCTAATGTGGACAATGTAGGCAGTGTCCATGTAACATACTTACCATTGGTGGACTATGAGGGAAAACTACTTCCTGTCCACTTTCTCTCGGCAGAAGAGCGAGGTAGTGAGGAGCGCTTATTACGTGAATGGCTAGACTGTTGTGTCACAGAGGGTGGAGTCCTGGTGGCTCAACAGAAGGTGACTTCAAGACCTGCCCTGCTCAATCAGTTGATTGATGATTGGCTGGACCGCTACAGGAAACTTTGCAAGAGCAAGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7M760	Ubiquitin thioesterase Zranb1 OS=Mus musculus OX=10090 GN=Zranb1 PE=2 SV=1
A6QP16	Ubiquitin thioesterase ZRANB1 OS=Bos taurus OX=9913 GN=ZRANB1 PE=1 SV=1
Q9UGI0	Ubiquitin thioesterase ZRANB1 OS=Homo sapiens OX=9606 GN=ZRANB1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009098 (this species only)
Ubiquitin family	UBD\|ZnF\|NZF · all ubiquitin genes in this species
Ubiquitin family	DUB\|OTU\|OTU · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF18418 all species →	AnkUBD	Ankyrin ubiquitin-binding domain	Repeat	Interproscan
PF02338 all species →	OTU	OTU-like cysteine protease	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001876 all species →	Domain	Zinc finger, RanBP2-type	Interproscan
IPR036443 all species →	Homologous_superfamily	Zinc finger, RanBP2-type superfamily	Interproscan
IPR041294 all species →	Domain	Ankyrin ubiquitin-binding domain	Interproscan
IPR003323 all species →	Domain	OTU domain	Interproscan
IPR049768 all species →	Domain	Ubiquitin thioesterase ZRANB1, ovarian tumor domain	Interproscan
IPR051346 all species →	Family	OTU Domain-Containing Deubiquitinase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13367 all species →	UBIQUITIN THIOESTERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004843 all species →	Molecular Function	cysteine-type deubiquitinase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0070530 all species →	Molecular Function	K63-linked polyubiquitin modification-dependent protein binding	Interproscan
GO:0071947 all species →	Biological Process	protein deubiquitination involved in ubiquitin-dependent protein catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11862	ZRANB1, TRABID; ubiquitin thioesterase ZRANB1	EC:3.4.19.12	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074614820.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

65TPM > 0

2Conditions

58.7Max TPM

22.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	33	16.61	46.85
all_coral_tissue · baseline	38	32	28.43	58.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.85
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.71
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.55
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.14
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.98
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.66
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.67
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.93
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.19
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.94
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.55
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.91
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.23
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.24
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.22
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.19
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.78
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.09
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.70
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.51
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.67
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.39
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.02
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.82
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.79
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.70
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.12
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.51
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.87
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.52
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.43
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.03
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.69
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.63
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.36
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.18
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.50
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.94
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.41
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.54
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.41
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.37
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.00
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.03
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.64
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.61
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.58
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.50
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.40
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.38
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.23
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.20
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.96
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.46
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.86
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.65
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.68
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.79
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.56
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.46
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.03
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.14
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.11
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.91
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.