Gene detail

Detailed information of XP_074615154.1 in Acropora palmata

Genomic Location: NC_133883.1:16360137...16378429
NR annotation: XP_015756863.1, PREDICTED: fibroblast growth factor receptor 2-like isoform X1 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074615154.1

ATGCAGGCAACGCAGTATTGGTGGACATTGTTGGTTAACTTTATTATCAATACACAGTCTGTTCGGCCCGAGCAATATCCGCCTCGGTTTGGGAAAAAACCAAAAGTTCAGAACAACGTTCAGGTAGGGCATAATGTTCGTCTCCGCTGTTCAGTTAAGGGAGATCCACCACCAAGATTAACTTGGGTAAAAGATCAAAAGCCTCTGCAGTTCTCATCTAGAATTCGACTTATTTCAAGAGACAATGGAATTGTAAAGATCAAGAACACCCAACTAGTTGACGCGGGAAATTACACCTGCATTGCAGCAAATTCTCTCGGCACAGTAAATGCAACCCTGGAACTCCTTGTACGTCAAGGGAGTTCAAACCCTTTCGTGCCAACAAATCAAGCTCCAACCGCAAGGTTTTCTGGAAAACATGCACCACCATCCTTCACTGACCAAAGTTTTCTAGAAAGACGATATAGAGCGTGGCCAGCGTCTCACACCATAAGGCTGAAGTGTGAAGCTACAGGAGCACCACCACTCCAATTCAGGTGGTTAAAAGATGGTCAAAGACTACTTTCAAGACGAATGGATCCATATCTTAATAGCTCACTGTGGTTCTTGAGACTAAGAGACGTAGTTCCTGACGACAGTGGAAAATACACTTGCATAGTCACCAACCCATATGGCAGTATAAACCACACTTATACACTTAATGTTGTGGCGAAACCACGATCAAGGCCATTTTTACAAAGCGACCTTCCGAGAAACACGACTGTGAAGCTTGGGGATAATACAACTATGAAATGTATTGTGCTGGTCAGTGGTACGCTTCCAGATTTCAGGTGGTTGAAATGGGACAAAAACATCACATCTCAACCCAAAATGAATGGCACGATGAAAGCTAATGGCTCAAACAAGCTTATTGATCCCATCCATTATAAAACCATCAAAGATGGCGAATATCATGGGGTGCAAGTAGAAATCTATAATGTATCGGACAATGATTTCGGACTTTACACGTGCTTTGTAAGTAACCACATTGGATATGACTACAACAGCGCTTTCTTGATAAAATTGGAGGAGCGTCCAGGGCCCACCACCTCAGTAGGGCACAATTGGTGGGAGAGTGCGTCCAATTTTCAAAACGGGAGTTCAACGGAACGGTCATTTCAAAAGGGAACTGGTCTGGTTACTGTCATCATGATACTGGTTGCGGCACTTCTCTTGTCCGCAACGATTGCCAGCATAATGTTCCTTTTCTATCGCAAGAAGCTTAAGCATAATTTACTGCAGGAAGAAAAAACTCAAGCGGACATCGTGAGACTTCACGAAGTGCCTGACATAATTGAAGGAACGTCAAACCTTTTGTTGTCAGAACCCAGCACTCCAAATCAAACCGACCAAGGCGCCAGAACGTTTACTTATCCAATTGCAAGGAGAAGATTGAGCTCTTCAGGATCGATTAACTCCACCACACCTCTGTTGAAGAACAGAAGTGGCAGCCATAGGTCACGCTTTTCCTCAGGAGTATCATCAAGAATTGACTCAAATATAGCAGAGGAGTTCTACGAGCTACCCTGTGATGAGGAGTGGGAAATTGAGAGATCTCTGTTAACAATTCGAGAACAACTTGGTGAAGGAGCATTTGGTTTGGTCATGCGAGCAGATGCTGTGGGATTGCCGGATATGCCTACGACAAACTCAGTGGCTGTAAAAATGCTGAAAGCCGATGCAACGGAGAATGAATTGGCCGATCTTTTGTCCGAAATGGACACTATGAAGGAGATTGGAAAACACAAGAATATCATTAATTTAATTGGTGCATGCACACAGAACGGCCCGTTGTTTGTTGTTGTTGAGTTTGCTCCCTTCGGCAATCTCAGACAGTTTCTAAGGGAGAGAAGACCCTCTGAGTATCAGCAGGCCAGATCAAGTGGTTCTGGTGGCTCTTCCCTAACCATCAGAGATTTTGTGTCTTTCGCGTTCCAAATAGCTAGAGGAATGGAATATCTTGGAACAAAAAAGTGTGTACATCGTGATTTGGCAGCCAGAAATATTCTCGTAGGGGAGGATCATGTCATGAAGATCGCAGACTTTGGCTTGGCCAGGAATGTGAGAGACCTGGAGTATTACAGAAAGACAACAGATGGTCGGCTGCCGATCAAATGGCTAGCCATTGAGGCATTGTTTGATAGGGTGTACACCACACAGAGTGACGTTTGGGCGTTTGGTATCTTGTTATGGGAGATTTTCACACTAGGTGGCTCGCCGTACCCCGGAATACCGATAGAAAAACTGTTTGAGCTCTTGAAGTCGGGATATAGAATGCAGAAGCCTCAAAATTGTCCTAATGATATATATGACATTATGTTAAATTGTTGGGATGAAAAGCAAAGCTCCAGAGCCTCTTTCACAGATTTGAGGAAGCTGTTTGATGCTATGCTATCGTCAATGACCAGCAAGGAATACTTGGAGATATTGGCTCAATCCATTGAAGATATGGCTGTTGAAATGAGCTCACCAATAAGAGATGATTCTGATAATAACGATGATCTTATAATTGAGTCTTCATGCTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P11362	Fibroblast growth factor receptor 1 OS=Homo sapiens OX=9606 GN=FGFR1 PE=1 SV=3
P16092	Fibroblast growth factor receptor 1 OS=Mus musculus OX=10090 GN=Fgfr1 PE=1 SV=2
Q04589	Fibroblast growth factor receptor 1 OS=Rattus norvegicus OX=10116 GN=Fgfr1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000215 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan
PF07679 all species →	I-set	Immunoglobulin I-set domain	Domain	Interproscan
PF13927 all species →	Ig_3	Immunoglobulin domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR020635 all species →	Domain	Tyrosine-protein kinase, catalytic domain	Interproscan
IPR036179 all species →	Homologous_superfamily	Immunoglobulin-like domain superfamily	Interproscan
IPR007110 all species →	Domain	Immunoglobulin-like domain	Interproscan
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR016248 all species →	Family	Fibroblast growth factor receptor family	Interproscan
IPR008266 all species →	Active_site	Tyrosine-protein kinase, active site	Interproscan
IPR003598 all species →	Domain	Immunoglobulin subtype 2	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR013098 all species →	Domain	Immunoglobulin I-set	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR050122 all species →	Family	Receptor Tyrosine Kinase	Interproscan
IPR003599 all species →	Domain	Immunoglobulin subtype	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24416 all species →	TYROSINE-PROTEIN KINASE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004713 all species →	Molecular Function	protein tyrosine kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005007 all species →	Molecular Function	fibroblast growth factor receptor activity	Interproscan
GO:0008284 all species →	Biological Process	positive regulation of cell population proliferation	Interproscan
GO:0008543 all species →	Biological Process	fibroblast growth factor receptor signaling pathway	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0004714 all species →	Molecular Function	transmembrane receptor protein tyrosine kinase activity	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007169 all species →	Biological Process	cell surface receptor protein tyrosine kinase signaling pathway	Interproscan
GO:0007275 all species →	Biological Process	multicellular organism development	Interproscan
GO:0033674 all species →	Biological Process	positive regulation of kinase activity	Interproscan
GO:0043235 all species →	Cellular Component	receptor complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074615154.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074615154.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

83TPM > 0

2Conditions

349.8Max TPM

176.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	46	177.52	336.23
all_coral_tissue · baseline	38	37	175.16	349.76

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	336.23
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	268.16
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	259.00
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	236.49
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	226.54
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	221.08
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	217.10
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	216.67
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	216.50
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	214.86
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	209.95
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	208.54
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	205.53
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	200.30
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	197.28
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	195.17
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	194.68
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	192.76
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	190.09
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	188.36
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	187.15
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	184.53
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	182.67
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	177.75
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	175.85
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	170.93
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	166.72
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	160.89
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	156.90
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	155.50
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	151.11
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	148.59
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	146.64
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	146.15
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	138.86
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	135.82
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	135.61
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	129.62
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	128.23
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	127.77
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	123.69
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	121.73
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	115.85
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	114.56
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	113.36
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	74.29
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	349.76
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	243.61
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	240.31
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	226.93
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	225.98
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	222.08
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	212.34
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	210.05
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	209.30
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	205.88
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	203.38
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	201.85
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	198.89
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	195.77
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	195.36
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	193.35
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	187.39
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	184.83
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	177.84
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	177.21
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	176.98
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	174.85
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	171.36
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	164.94
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	164.01
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	161.45
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	161.13
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	159.74
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	156.51
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	152.66
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	137.59
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	135.09
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	130.46
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	114.68
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	89.68
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	80.27
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.52
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.