Gene detail

Detailed information of XP_074615193.1 in Acropora palmata

Genomic Location: NC_133883.1:890046...907704
NR annotation: XP_029188579.2, dymeclin-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074615193.1

ATGGGAGCTAAACCTTCCTCAATTAGCGACCTACAACATAATCCTGTCCTTCAGATTTTTACAGGGGAGAAAGCGGTCGGAGAAGATGACGAATTCTGGGACGATATCCTTGCATTTTCATTTCAGGCGCCATACAACAGTGCTGATGCAAGATTATTGGAGGAAGCAACAGAACCAATCTGCCAAAAACTAGTGGCAAATAATTTGAAATCAAGAAATTTTCTAACACTGATTAAAGTTTTTCTAAAGAGAATTCCAAGTCTTAAAGATGGCACCAAAAATGATGATGAGGCATTTATGTGGGAGATGTACAATGCCATCCTTTTGGTGCGAAGTTTCTCAAAGTATTTTATTGAATTTTTACCCAATGAGGAGGTCATAAAGCAGTTTGGTGGTGAAGCAGTCAAGACCGAGGGGGATGAAAGTGTTTCTGGTTTCACTGAACAAGTGTCTCATTACAGAGACTGTGGTGTTATAGAGGAGCTTTTCTGTGAGCTTATAGATGTCATCATAAATGTACCTGTTAGAGAAGGAACTTATCCAATCCATGTTGAAGCAATCAATACATTATTGGTTCTTTTGTCTGTACAAATGTTTGATCCAAGAGCATCACATAACAGCATATTCTACCAAGTTATCTTGAAAAGGGGAGGTCAAAACTGTGGGCATGATCTTGTGAGAATTCTGTTAAAAAATTTCATCAGTAAAGAAAAGACACCACCGGAACTGACAGTAGCAAACACTGGAGGCTGGTTCTCTAGTGTTTGGTCTTGGTTTGGTTCTCAAAGTTCTGAGGATGAAGATTTATCGCTCCTGGCCAATCAGAGTTTACTTCTGCTCCTTGTTCTTGTGAATCATTGTACACAAGACAAGCAGCAACTAAACCCTTACAGGCATGCCTTGTTTTCTTTTGCAAACAGAAATGTCAAAGACACTGTGGCTGAAGACGGTGAATCTGATAAAGAATGTGCCCCACCATTTACTCTTCATATCGGCATGCTTTATACGGCAATTTGCACAGACTTGCATAAGGACCAAACAACACTTCTGTTGTACTTACTGCTGCATCGAAATCCAAATGTATCAACTTTTATCCTTTCAAAAACAGATATTGATAACTTGGTGATGCCCATTTTAAAATTGCTTTACAATGCAGATAATCACAATGCTCATCACATTTACATGTCTCTTATTATCCTGTTGATTCTAAGCCAGGATGATAACTTCAACAAATCTGTCCATGAACTGACGATCCCGTCAATTCCATGGTACAAGGAGCGAGTTATAACGAACATCACTCTTGGTGGACTGCTGGTGTTAGTTGTGCTTCGGACAATTCAATACAACATGACAAAAATGAGGGATAAATACCTTCACACGAATTGTTTGGCAACTTTAGCAAACATGTCTTCTCAATTCCATGCTCTCCATCCGTATGTTACACAGAGAATTGTGAGTTTATATGCACTTCTTTCCAAAAAGCACGCGAAAGTAATGGAGCTTATAAAACAAACTGAAGGCAGAACATCAGCCAATACACAGGAGGGACAACACACTGATCATCTGGCAGACTTGGCGATCCTTGAAGAAGTTATTCGCATGGTGCTGGAGATAATAAACTCTTGTGTTACCAACACTCTGCATCATAACCCCAACCTGGTCTATACACTCCTACACAGACGAGAACTGTTTGCGCAGTTTAGAACACATCCTACATTTCACGACATTATACAGAATATTGACACAGTGTTGTCCTTCTTCAGTGCTCGTCTGGAAGAGCATCCTGACCAGACTTTGTCTGTTGGCGTTGTGTTAGATGTAATTAAACAAGGAACGCTCAAATGGCCGAGAGAAAGATTAAAGAAATTTCCTGAACTTAAATTCAAATACGTCGAAGAAGAACAACCGGAAGAGTTTTTTATTCCGTACGTGTGGTCACTTGTTTATAAATCATCCTCAATGTACTGGAACCCAGATCACATTCAACTCTTCCATCCTGAATCGGAGGAGACTAAGTTCTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZLW3	Dymeclin OS=Gallus gallus OX=9031 GN=DYM PE=2 SV=1
Q7RTS9	Dymeclin OS=Homo sapiens OX=9606 GN=DYM PE=1 SV=1
B4F766	Dymeclin OS=Rattus norvegicus OX=10116 GN=Dym PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007127 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF09742 all species →	Dymeclin	Dyggve-Melchior-Clausen syndrome protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019142 all species →	Family	Dymeclin	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12895 all species →	DYMECLIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005794 all species →	Cellular Component	Golgi apparatus	Interproscan
GO:0007030 all species →	Biological Process	Golgi organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23951	DYM; dymeclin	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074615193.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

74TPM > 0

2Conditions

63.1Max TPM

27.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	24.97	63.14
all_coral_tissue · baseline	38	34	29.35	43.35

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.14
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.23
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.89
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.30
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.69
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.08
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.98
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.80
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.44
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.98
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.79
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.53
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.95
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.71
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.00
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.83
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.03
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.68
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.79
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.52
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.16
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.10
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.60
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.30
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.51
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.50
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.85
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.79
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.20
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.79
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.57
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.28
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.02
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.72
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.65
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.25
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.67
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.59
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.90
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.77
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.35
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.47
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.41
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.98
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.64
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.44
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.28
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.23
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.00
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.47
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.09
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.83
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.76
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.72
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.54
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.91
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.86
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.84
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.56
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.55
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.64
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.97
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.25
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.99
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.19
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.46
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.30
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.46
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.33
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.92
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.60
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.71
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.65
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.05
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.