Gene detail

Detailed information of XP_074615355.1 in Acropora palmata

Genomic Location: NC_133883.1:51316...82618
NR annotation: XP_015754548.1, PREDICTED: glutamyl aminopeptidase-like isoform X1 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074615355.1

ATGATGGTACATGTACCGCTTCTACAATTGCAAGAGGAAGAAAGCACATGTGCAAGCCCAGTAATCAAAGGAGAAAGTTATGTATCCCCCAGAATTGTGAACCAGCGGACTGTTTTTGCTGTTGTTATTATTATACTGGTTTTGGTGGCACTGGTTATTGTCCTGGGAGCTCTATACGGCGTAGAACGAGCAGAACGAAAAGCTCAAGGAGACCGATGGGCAAAGACAACTCCTGCGACAATGGAACCAACACCTACCATTGGTCCAACAACACCGGGCACTGAAGTATGGTGGAAAGTTCGACTTCCCCACAACGTTGTTCCCGATCATTATGATGTTGAGTTGAACATTGACCTTGATAAGGCGGAGTTCAATGGAAGTGTAACTATTCTAGTAACAGTACGAGAACCAACTGAGAATGTGCTGGTCCATGTCAACAAGATGAAAATTACATCTGCTTCGGTGGAAAAAGCCTCAAGTGGAGGTCAACTAGGGATAGTGCGGAAGTTCTTGTTTGAAAAAAACCAGTTCTATGTGATTATTCTGAAGTCGGCATTGGAAAAACAAATTCAATACAGAATAAAGATGAGGTTCAAGGCAAAGCTAACAGACGACTTGGCAGGACTGTACAAAAGCACCTATAAAAGAAAGGATGGAACTGAAATAGCCATTGCAGCCACCCAGTTTCAACCCACCGATGCACGGAGAGCATTTCCATGCTTTGACGAGCCGGCACTGAAAGCTACATTTAGCGTTACCTTAGGACATAATCCCAAGTATATATCTATTTCAAATATGCCTATTGAGAGCAGTGAGATGAAGGACAGTCTTCAGCTAGACCACTTTCAGAAAACTCCAAAAATGCCAACTTATCTACTTGCTTTTGTGGTATGCGACTTTGCGAACAAAACTAAGACCACCAGGAATGGAACGAGGATGACGCTTTATGCTCCACCGGATCAAATTGATCAAGTAGATTTCGCTATGGATAACGGAATTAAAATGTTGCAGTTCATGGAAGGATATTTCGGCATTCGTTATCCTCTTCCCAAGGCGGATATGATAGCTATCCCTGACTTTGCGGCTGGTGCAATGGAGAATTGGGGGCTGATAACGTATCGAGAGACAGCTCTGTTGATCAAATCAGGCGAATCAGCGGAGACTAACAAGAAACGTGTAGCTGCGGTTGTATCTCATGAACTTGCTCATCAATGGTTTGGCAATTTGGTAACAATGAAATGGTGGGATGACCTGTGGCTCAACGAAGGTTTTGCCAGCTTTGTTGAGTACTATGGAGTCAATGCTACACAACCAGACTGGAAATTGCTGGACTCATTTGTAGTGGCCGATATGGCAAGTGCCTTTTCTCTGGATGGCCTGACCAACTCACATCCCATCAAAGTTCCTGTGAATCATCCTGATGAAATCAATGAAATATTTGACTCTATTTCATACAACAAGGGAGCGTCAATAATTCGAATGCTTCAGTATTTCCTTGGAAAAGATGTTTTCCTGAAAGGCTTAAATCGGTATCTCAATAAACATCTGTACGGAAACGCGGAAACTGACGACTTGTGGAATGCCCTCGAGGAGGAGTCCCGAAGTAGAGGCAACTTCAAACATGTCAAGCAAATGATGGACACGTGGACTCTACAAATGGGTTACCCAGTCTTAAACATCAACCGAATAGGAGCACACAAATACAATGTGTCACAGGAGAGGTTCCTTTATGACCGCTCTGGAAATTTCACTTCCAAATACAACTCTCCATTTAGCTATAAATGGGTAGTACCCTTTACGTACTTCACAAATGCCAGCTTGGACCCTGTGACAAAGCTCCTTAATATGACTTCAGTGGAAATCGACTGGGACGGCAGTGGATGGCTAAAAGCAAATGCTGGCCAAAGAGGGTACTACAGAGTCAACTACGGGCAAACTCTATGGAAGCGATTGGGAATCCAGATGGAAAATAATCATGAGGTTTTCAAATCCACTGATCGGGCAGGATTGATAGATGATGCATTTAATCTTGCAAGGGCCGGGTACATAAAGTACTCTATGGCATTCAAGTTAACCAAATATCTGAGAAAAGAAGAGGAATATGTGCCTTGGGAAGCGGTCACCAACAATGTAAACACAATCAAGAGTATTCTGCCGAGGTCCAGTCCCAGTTTCAAGTATTTAGAGAAGTACATTTATAATCTATCGTTTCCATTGTATCAGAAGCTTGGTTTTAACGATACAGGAAGTCACTTGGAAATATACAAGCGAAATATAGTGTTAGGGACCATGTGCGGTGCAGGAGAAAGTTCTTGCCTCAGCCAGGCTTCAAGATATTTTCAGAATTGGATGGAAAAGAACCAGTCCGTTCCTGCTAACTTCCGTTCGTTAGTCTACTTTTATGGTATAAGAAATGGTGGTGTTAAAGAATGGGATTTTGCCTTCGAACAATTTCAAAAGACCACAGTTGCAAGTGAAAGAAGAAACATTCTCTTTGGTTTGTCTGGTACAACCGAATCCTGGATTTTGACAAGGTACCTAGAATATTCCATTGATTCTACCAAAATAAAGGCGCAAGATACTTCCAGAGTGATTTATTATATCGCAAACTACAATCCTCAAGGACGGCACCTAGCGTGGCAATTTTTGAAAATTAACTGGAATTTCATATTGAAGAAGTTTGGTGGAGGATTCTTTTCTATCAGAAATGTGATTCTTGGCGTGACAAGTGGGTTTGCTACAGAATTTGAACTGCAGGAGCTTAAGAAATTTAACGAAAACAACGCTGCTGGTGCCGGAGCGCGAGCTCAACAACAAGCTGTTGAAAGGGTGATGGCGAACGTGCAATGGCGCAAACAAAACGAAGAAGATGTAGAAAACTGGTTAAGGGACTACCTTGCAGTCAACAAGATATCTGTTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q32LQ0	Glutamyl aminopeptidase OS=Bos taurus OX=9913 GN=ENPEP PE=2 SV=1
Q95334	Glutamyl aminopeptidase OS=Sus scrofa OX=9823 GN=ENPEP PE=1 SV=1
P50123	Glutamyl aminopeptidase OS=Rattus norvegicus OX=10116 GN=Enpep PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000201 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17900 all species →	Peptidase_M1_N	Peptidase M1 N-terminal domain	Domain	Interproscan
PF11838 all species →	ERAP1_C	ERAP1-like C-terminal domain	Domain	Interproscan
PF01433 all species →	Peptidase_M1	Peptidase family M1 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027268 all species →	Homologous_superfamily	Peptidase M4/M1, CTD superfamily	Interproscan
IPR034016 all species →	Family	Aminopeptidase N-type	Interproscan
IPR001930 all species →	Family	Peptidase M1, alanine aminopeptidase/leukotriene A4 hydrolase	Interproscan
IPR045357 all species →	Domain	Aminopeptidase N-like , N-terminal domain	Interproscan
IPR042097 all species →	Homologous_superfamily	Aminopeptidase N-like , N-terminal domain superfamliy	Interproscan
IPR024571 all species →	Domain	ERAP1-like C-terminal domain	Interproscan
IPR050344 all species →	Family	Peptidase M1 family aminopeptidases	Interproscan
IPR014782 all species →	Domain	Peptidase M1, membrane alanine aminopeptidase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11533 all species →	PROTEASE M1 ZINC METALLOPROTEASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0042277 all species →	Molecular Function	peptide binding	Interproscan
GO:0043171 all species →	Biological Process	peptide catabolic process	Interproscan
GO:0070006 all species →	Molecular Function	metalloaminopeptidase activity	Interproscan
GO:0008237 all species →	Molecular Function	metallopeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11141	ENPEP, CD249; glutamyl aminopeptidase	EC:3.4.11.7	CD molecules	ko04090	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074615355.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

78TPM > 0

2Conditions

196.1Max TPM

82.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	44	72.36	156.09
all_coral_tissue · baseline	38	34	94.50	196.08

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	156.09
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	155.80
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	141.53
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	136.57
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	135.79
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	131.82
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	126.76
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	125.28
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	120.93
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	117.82
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	112.98
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	107.65
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	106.38
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	104.96
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	101.04
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	96.95
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	92.57
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	92.05
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	90.86
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	89.42
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	84.20
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	82.42
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	72.43
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	68.33
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.58
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	58.45
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.84
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.01
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.37
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.36
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.61
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.87
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.74
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.42
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.90
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.60
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.76
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.51
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.81
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.96
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.71
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.71
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.02
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.46
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	196.08
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	194.61
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	179.88
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	150.72
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	150.62
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	149.16
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	147.96
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	146.85
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	145.03
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	144.25
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	142.49
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	139.17
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	138.22
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	130.62
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	121.38
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	119.70
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	114.44
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	114.41
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	111.91
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	100.18
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	97.12
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	91.75
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	88.23
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	85.69
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	79.11
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	68.33
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.98
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.08
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.77
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.26
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.89
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.36
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.57
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.12
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.