Gene detail

Detailed information of XP_074615367.1 in Acropora palmata

Genomic Location: NC_133883.1:21853792...21868252
NR annotation: XP_029211942.2, histone-lysine N-methyltransferase NSD2-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074615367.1

ATGGCAGCAGTGGAATCTAAAGATGATAGTGCTTCCTCTGAGCTGTCAGAGAGTCTGCATGCCAAAGATTCGAAAGTTTCTTCAAGTCCGAATCAAACTGCTTCGTGGCTCGTCGGAGATGTAGTATGGTCGAAAATCCCAGGCCATCCATGGTGGCCTTCGATGGTTTCTTACGATCCTAACACCGCTGTTTCGTTCAAGTACAAGGGGAGAGCAAGATTTTATCACGTGCAATTTTTCGGTCAGGATCCTGTGAGAGGCTGGGTCGCTGAAAGGTCGATCTTAAAATTCGAAGGGAGACAAAACTTTGAGAATTCACTTCATGGAAAACAGTTAAAGATTGCTCAAAAACGTATTTCCCTTTGGGAATCGGCTGTCAGTGTGGCTGAGAAAGCAAAGCCAATGAACAGACATGAACGGCAACTGTGTTACACCTTCAAGTACTATGACAAGAATGAAACAAAAAAGATTGATCCTTTCAAAGTCAAAAAGTTAAATGGTTTTAGCTCAGTGCCTGGCTCTGCCACTTTGGCAGAGCATGTAAATGGTGTCGATAGTAGCCACCAGGAAAGGACATGTGATTCCAACAATTCTGAAACACCGGTGTCAGAACCAGTAGCCATCAATGGAGCTGAGAATTGCAATGATAGCTTGAAGTGTGCACAGAAGAAAACTGTGAAAGAAAAACTCCCACGTAAACGAAAACTGGGTTCTTCGTCAGGGACTGCAAAGTCTCCCAGGGACCTTGTTGAATCTTCCAAAAATGTTGAACCTCCAAAGAAAAAGAAAAAAAGGACTTTGAAAGGAAGCAAAGAATTAAACTTGTCTGAGTCAGATTTGGTTGCCAACGACACTAAGGAGGCGATGAAAGCAAACTTGAGCGACAAACACTTTTCAGAAATAGATAAAAAATGTAATGGTTTGTACAATACCCCTGATGCTACTCCTCCAAGAATAAATGGCGATGTATCTTCTTTCATTGATGCAATGGAAGTGTCACCCAACACTGCATTGAAGTTGAAAATCCGCAAGATTACACCAAAGCAAAACCAAGCTGAAGGCAAACGTAAGAGGGGAAGGCCAAGAAAACCACGATTTGTGATAGTTAGTGAAGATGGTAATGAAAATGAAGGTGCAAGTCAACAGGTTTTGCCAATGGATGTGGAGAGCAAGGAAATTTCTAATGTTCATGCAAAATCAACTCTATTCACAGAAACCAATGCAGAAGACATCCCAAAGAAGAAGAAACGCATTCCAAAGCCAACTAAAAAGATGTTAAATGCCAAGGAAGCAGCCTTGTTGCCAAGTAAGGACATGCCTATCTTAAAAGGGAAAAAGAAACTAGCACCAAAAAATGAATGTGTGGCAAAGACAAAAGAGAAGATTGAAGTAAGCAATGCAAAGTTAAAATCTCCAAAAGGGAAAGTTCCATCAAAAAGTGAAAAGGTTAAAAATGTGGAGGATAAGAAAAGTGAAGTTTCTACTGCAGAAACAAGTGTTCCTGCCGTTGAAACTGAGGGTAGTGTCACATCATCAACGGACGATACTGGAAGTATTAAGAATGGCACAGTTTCTAAAAGGGAAAAGGATGGAGTTTGTATTGTGTGCGAACAACAGGAAAATCTAATATTTTGTGAGGGGATTTGTGGAAATTCCTTCCATTTGGACTGTATTGGGCTTTCAGTGGTTCCAAAGGGCAAATTTGTCTGTGACGAGTGTGTGACTGGCAATCATTGCTGCTTTGTTTGCAGACAAGCGGGAAATGTGAAACAGTGTAGTCAACCAATGTGTACAAAGTATTATCATGACGAGTGTGTTAAAACATACAAAACTGCCAAGTTTGATGGCGATCGCTTTTTCTGTCCTCTTCATTTCTGTACTACGTGTGTTTCAAACAAATCTGTCGTGTCTAGAGGACGCTTGATTCGTTGTGTACGTTGTCCAACTGCGTATCACATCTCTGGCTGCCTTGTGGCAGGTTGTATTCCAATCTGTTCCAATCTAATGGTCTGCTCAAAGCACTTTATACGGGATAAAAATAAGGCTCATCATACACATGTGAATGTAAACTGGTGTTTCGTTTGTTCAATTGGAGGCACATTGATTTGTTGTGAAAGCTGCCCAGCATCATTTCACCCTGAATGCATCAGTTACGAGGGCATTCCAGAGGGGCATTTCTTTTGCAAGGATTGTGCGGAAGGAAAACATCTTTTGTATGGAGACATTGTGTGGGTCAAGCTTGGAATGTACAGGTGGTGGCCAGCACAGATTTGCAATCCCCGTGATGTGCCCACCAATATCCAGAACATGCGACACCAGCCTGGAGAGTTTCCTGTGCAGTTTCTTGGTTCACATGATTATTATTGGATTCACAGAGGTCGGGTTTTCAGCTATCAGGAGGGGGATAAGGGATCTTCTGATTCTGGCAACAACAAAAATCTGGCAAAAGTATTCAAAAAAGCTCTTGCTGAGGCAAAAGAAAAGTATGCAGAATGGAGGACGCTGCAAGAAAGCAAAGCAGAGCAAGATCTCCAGAAGATGTCCAAGAAACCAGCTCCATACAAACAGATAAAGGTAAACAAATGCACAACAGCCATCCGCATTGTGATCGATCCTTCAGAACTTCCTATGTGCGATTGCTCGGCAAGCAATGAAAGCCCCTGTGGTCCGGAATCAAATTGTTTGAACCGTATGTTACAGTTTGAATGCTATCCTCAAAGATGTCCTGGAAAGGAAAACTGCCAGAATCAACGGTTTCAAAAGAGGCAATATGTGGATTGCGAACCTTTCCGAACGTTGCACCGTGGATGGGGATTGAGGTGCAAAGAGGATGTGAAGAAGGGTCAGTTTGTCATTGAATATGTTGGAGAGCTTATTGACGATGCTACATGTCAAGAGCGTGTGCAGAAAGGAGAGGACATCACCAACTATTACATGTTGACAATAGACAAGGATTGCATAATTGATGCAGGCCCAATGGGAAATCTGTCACGATTTATGAATCATAGTTGTGATCCAAACTGTGAGACACAGAAATGGACAGTAAATGGAGAAGTTAGGGTGGGACTGTTTGCTTCAAGAGAAATAATGGCAGGAGAGGAACTTACGTTTGATTATCAGCTTGATTGTTTAGGCAATGAAAAGAAGAAGTGTCATTGTGGAGCCAAAAACTGCAGCAGTTTTCTTGGAGTGAGGCCAAAGAACCAGGTTCAGGAGGATAAAGCAAAGAAAACAGGAGACAAAAGAAAAAAGAAAAGAATCAAGAAAGCTGTGGTGAAAGAAGTTCATGAGGATGAATGTTACATCTGTGGTGATGGCGGCGAGCTTCTTATGTGCGACAAGGGAGGCTGTAAAAAGTGCTATCATAAAACCTGTTTAGGCAGTGACGTCAACACACGAGGCAAGTGGATATGTCCGTGGCATTTCTGTGACGATTGTGGCAAGTGGGCAAACATCATGTGTTCAGAATGTCCAAACTCATATTGCAGAAGCCACGCATCAGGTCAAATTACGGAATTAGCCAATGGGGTTCATTTGTGCTGTGACCATATTGTAACAAGGAACAGTCCTGTGCAAAACCAGGCTTTTGAAGAAGAGAAGGTGGACCACAGCAAACCCAATGCTGATGTTGAATTATCACATGTGGGTTTGGAATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O96028	Histone-lysine N-methyltransferase NSD2 OS=Homo sapiens OX=9606 GN=NSD2 PE=1 SV=1
Q8BVE8	Histone-lysine N-methyltransferase NSD2 OS=Mus musculus OX=10090 GN=Nsd2 PE=1 SV=2
Q9BZ95	Histone-lysine N-methyltransferase NSD3 OS=Homo sapiens OX=9606 GN=NSD3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002896 (this species only)
Ubiquitin family	E3\|E3 activity RING\|PHD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00855 all species →	PWWP	PWWP domain	Domain	Interproscan
PF17982 all species →	C5HCH	NSD Cys-His rich domain	Domain	Interproscan
PF17907 all species →	AWS	AWS domain	Domain	Interproscan
PF00856 all species →	SET	SET domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019787 all species →	Domain	Zinc finger, PHD-finger	Interproscan
IPR000313 all species →	Domain	PWWP domain	Interproscan
IPR001965 all species →	Domain	Zinc finger, PHD-type	Interproscan
IPR041306 all species →	Domain	NSD, Cys-His rich domain	Interproscan
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR050777 all species →	Family	SET2 Histone-Lysine N-Methyltransferase	Interproscan
IPR019786 all species →	Conserved_site	Zinc finger, PHD-type, conserved site	Interproscan
IPR006560 all species →	Domain	AWS domain	Interproscan
IPR003616 all species →	Domain	Post-SET domain	Interproscan
IPR001214 all species →	Domain	SET domain	Interproscan
IPR046341 all species →	Homologous_superfamily	SET domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22884 all species →	SET DOMAIN PROTEINS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0042054 all species →	Molecular Function	histone methyltransferase activity	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11424	WHSC1, MMSET, NSD2; [histone H3]-lysine36 N-dimethyltransferase NSD2	EC:2.1.1.357	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074615367.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

70TPM > 0

2Conditions

31.5Max TPM

13.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	38	11.60	31.47
all_coral_tissue · baseline	38	32	16.31	30.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.47
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.49
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.16
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.75
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.94
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.72
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.12
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.05
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.04
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.44
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.28
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.82
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.50
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.93
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.19
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.81
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.47
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.76
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.55
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.05
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.21
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.32
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.91
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.25
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.92
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.61
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.34
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.12
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.21
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.94
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.84
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.80
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.78
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.60
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.33
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.00
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.00
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.92
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.48
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.47
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.44
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.11
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.04
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.77
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.65
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.48
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.74
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.29
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.22
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.05
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.51
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.16
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.08
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.49
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.24
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.45
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.00
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.56
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.43
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.38
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.93
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.04
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.08
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.68
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.54
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.43
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.05
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.00
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.73
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.29
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.