Gene detail

Detailed information of XP_074615449.1 in Acropora palmata

Genomic Location: NC_133883.1:8930197...8975720
NR annotation: XP_029200813.1, zinc finger MIZ domain-containing protein 1-like isoform X5 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074615449.1

ATGGAGCTCGAATACATAGATTTGGAAACCACAGGGATAGCCAGCACTGGTGCTGGAATGAGCTTGAGCATGGAACGGCATATTCAGCAAACTAATGAAAGATTACAATGCATCAAGCAACATTTGTCCACCCCACAAGGGTTTCAGACATCTGCAAGGGAACTTCTAGAGTGGTGTGGGGATGTAAGAGCTTTTCAGAGAGCCTTTGAAAGTAATTTAATGGGATGCCTCACAGTTGTGAGTCAAGTTGCACCAAGCCCAGGCTATGATTTGGATTTGGGTTATAGACTTCTAGCCATTTGTGCTGCACATAGGGATAAGTTTACATCAAAGTCAGCAAATATGTTAGGTGTCTGGTGTGAAGACCTTGGCAGGCTTCTTCTATTGCGACACCAGAAGCAAAGAAATGACACACAGAAGACAGTGGGATACCCTGGTCAACCCAACAAGATAAGCCAAGTGTCAAACCAGATGAATCCAATGAATGCATTAAATCCACTTGCCAACAATGATGCGTCAACTGTCATGTGGCCACAGACCACACAAGGACATGGTCAACAGCAACCTTCTCTGTCTGTGGTGACAACGGTATGGGGAGTCACGTCATCCATGACGAATGGAACAGCAAACATGACACATGATCCTTCCAATCCTGGAATTCCAACCACAAATACTGTTAACTCTGTGGGGCATCCATACCTTTCAACTTCAGCAAATCCAAAGCCATATGCTCAACAAGGTAGTTATCCAGCAAGACCAGGAAACAGACTTCCTCAAGAAACACCAACAGCATCACCATACCTCCAACGACAAAACAGTTTCCCAACTGCTGGGGCCACACCTTCAGTAAATCCTGGAAGTAACCATTACTATTCACAGCAGAATTCAGTTCCACCCAATGCATCCCCATTCCCACAGGCAACTGCAAACCCAGCAGCAGCAGCTGCAGCTGCTGCAGTTGCCGCAGCTGCTGCCACCGCGACAGCAACGGCGACAGCTACAGCTACAGCTGCTCTTCAGGATCAGCAACAAATGGATTACAATGGATTCCCTGCAAGCCAAAACCCATATCCACCAAATCAAGCCAGTCACCCTCAGCACCCGCCGCCCCCTTATCAACGCAGCAATAGTTTTCCACAGTACCAGCAGCCTTTTTCTCAGCAGCAGCAACATGGGACCCAGCAGGGTATGCAGAAGCCCAACTCAGGCATGAGTCGTGCATACATGCAGGAGTTTGTGATGCGAAGTAGGCAACAGCAGCAACAGCAAATGCAACAACAGCAGCAGCAGCAGCAGCAGCAACAACAAATGCAACAGCAATACAAACAGCAGTATTCTGCATCTTACGGGCAGAGTGCATATAACATGTCGTCTGGCTATCCACAACAGGGTGGTTACCAGCCACCAGGAGCTCCCCCTCCCCCCTACTCGCAAAGTGTGAGCCCCATGACACAGATGAACCAACAAATGGGACAGATCATGCAAGGAAACACCATGAACCAACCTGTGGGACAAATGAACCAAACCATGGGACCTCAGTTGGGTCAATTGAGCACCATGGGAGCAATGAACCAAATGCCACAGGTGAACCCAGGAGGACACATGTCACAAATGACTCCAGCCTCACAAATACCACCAGTGAACCAGGTGCCACCAGTAGGAGTGTATGGATCACATATGCCACAACAAGGAAATCGTCCAATGGCCAGACGGCGCAAGAGTCAGTATCAGAACTCGCCATTGGCAAATGCTTTATCTCCTCCAGTCACACCTGGACCTATACCAAGCCCTTACATGAGTATAAGTGATGTTGGAAATAGTCCTGCAAATTGTTATGATATAAAGCCGCAAGTTGTTCCCAGTACTGCATCACCACAGGCTTATGAGGATATCAAACCTCCAAGGTTAAATATACCTGAAAATGATGTTATCAGGCTAACATTTCCAGTACGAGATGGTATCGTTCTGCCGCCGTTCCGACTGGAGCACAATTTAGCTGTTAGCAACCACGTTTTCCATCTTCGAGACTCTGTTCACCAGACGCTCATGATGAGACCTGATCTCGAGCTACAATTTAAGTGTTATCATCATGAAGATAAACAAATGTACACCAACTGGCCGGCATCGGTCACTGTTAGTGTGAATGCTAATCCGCTAATGATAGAGAGGCAAGGAGATAACAAGACGTCGCACAAGCCCCTTCATCTGAAGAATGTGTGCAAACCAGGAAGAAATACCATCCAGATAACAGTCACAGCATGTTGCTGTTCTCATCTCTTCGTCCTCCAACTGGTTCACAGGCCATCTGTCAGCTCTGTTTTACAGAGTTTGCTTCGCAAACGGCTTCTGCCCGCCGAACATTGTATCACAAAAATAAAAAGAAATTTCTCGTTATGCTCATCGGCTGCTGGCGGTAATGATGACAGTGTAGAACAAACAGCCATCAAAGTGTCTTTGAAGTGTCCTATCACGTTTAGAAGAATAACACTGCCAGCGAGAGGGCATGATTGCAAGCACATTCAGTGTTTTGATTTAGAGTCGTACCTGAGACTGAACTGCGATAGAGGAAACTGGAAATGTCCAGTTTGTAGCAAAGTGGCTCTACTGGAAGGACTTGAAGTGGATCAGTTTATGTGGGGCATCCTCACAACATCCAGATGCACTGACGTGGAGGAGGTAACAATCGATCCAAACAGCCAATGGAAACCTGTTGCTGTGAAGCAAGAACCAAAAGAGGAAGACTGCCCAGGGCCACAGCCTGCTAAGAAAGCACGCCCATCACCACCGGATTCGCTGCCACTCACCGGTGTCCGTACGCCAACTTCCATGTCCAGTAGCAGTGGTCATTACTCTCCCTATCAGACACAACCGCCTTCGAATCCAGGCATGGGTGCGCCCACTCCCCCTGTGCGGACACCACCCGAGACACACAGTTCCTCTGTTGCAGGAAATTTATCCGAGCAGACAAGTAGCAATAATACAGGGTCTGTTCAGACGGCCACAACGCCCAGTGCTGATAAAATGACCCCAAGCCCGGCTACAAGTCAAGCCAACACCCAGAGTGTCAACAACCGGGGTCCCTCCACCCCTCAAACACCGGGAGGCAGTCACTCAACTGGTCAAAAGGGCCAGGCAGGAGATAGGACGCAGCATTCGTCATCTAGCCTTCCTCAGCCACCGGTGTCTGGAAATGCTGAGAGCATCACAGCCGATCTGGAGTCTGACAATCTCTCGGAAGAGTTTAGCTTCGGTGTTTTGGAAGGTGATCATGGCGGCGGGACAGATGGAGTCGAAGGTGCCCTGGATGTCCTTCCCGGGACACTGGACCCAGAAGAACTCTTTAATTACTTGACACCGTCCGACCTTCCTAGCGAAGACATATTGTCAATGTTCGAGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9ULJ6	Zinc finger MIZ domain-containing protein 1 OS=Homo sapiens OX=9606 GN=ZMIZ1 PE=1 SV=3
Q6P1E1	Zinc finger MIZ domain-containing protein 1 OS=Mus musculus OX=10090 GN=Zmiz1 PE=1 SV=1
Q8NF64	Zinc finger MIZ domain-containing protein 2 OS=Homo sapiens OX=9606 GN=ZMIZ2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001604 (this species only)
Transcription factor family	zf-MIZ · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02891 all species →	zf-MIZ	MIZ/SP-RING zinc finger	Domain	Interproscan
PF18028 all species →	Zmiz1_N	Zmiz1 N-terminal tetratricopeptide repeat domain	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004181 all species →	Domain	Zinc finger, MIZ-type	Interproscan
IPR040797 all species →	Domain	Zmiz1, N-terminal tetratricopeptide repeat domain	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10782 all species →	ZINC FINGER MIZ DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0000790 all species →	Cellular Component	chromatin	Interproscan
GO:0003712 all species →	Molecular Function	transcription coregulator activity	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0016925 all species →	Biological Process	protein sumoylation	Interproscan
GO:0030374 all species →	Molecular Function	nuclear receptor coactivator activity	Interproscan
GO:0061665 all species →	Molecular Function	SUMO ligase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K22403	ZMIZ; zinc finger MIZ domain-containing protein	-	Transcription	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074615449.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

79TPM > 0

2Conditions

88.2Max TPM

37.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	43	37.72	88.18
all_coral_tissue · baseline	38	36	38.00	66.60

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	88.18
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	80.21
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.35
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	75.30
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	73.91
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	71.32
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	70.57
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	67.53
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.08
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	59.84
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.63
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.81
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.98
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.52
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.78
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.65
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.61
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.80
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.58
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.43
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.83
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.58
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.67
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.44
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.24
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.14
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.02
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.53
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.32
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.08
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.63
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.88
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.85
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.41
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.73
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.00
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.85
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.68
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.75
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.37
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.96
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.35
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.83
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.60
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	65.99
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	65.35
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	60.22
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	59.11
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.92
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.54
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.96
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.84
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.52
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.87
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.31
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.03
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.44
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.44
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.67
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.43
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.10
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.67
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.30
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.65
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.81
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.32
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.92
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.11
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.91
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.60
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.86
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.30
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.44
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.26
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.39
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.38
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.95
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.83
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.79
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.