Gene detail

Detailed information of XP_074615519.1 in Acropora palmata

Genomic Location: NC_133883.1:7726960...7736674
NR annotation: XP_015757200.1, PREDICTED: uncharacterized protein LOC107336643 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074615519.1

ATGAGAGTTGCGTTGGTTTTTCCGTTGTTTCTGACTTTCACAATCCGAGTGTCGCAAGCTTTTGAGTGCCTGGAACCATCGGCCAGAGTTATCAGCCGGTGGAAAAATGGAAACTATTACAAGGGCGAGATCGACTCAATAACTAACAGAGTGAACGTGTTATTTGATAATGGCGTTCGGCTGGCGTATAGCCCACGTGACAATGTGGACATTGTGGTTGACAGAATCCCTGATCACAGTGAACTCCCATGGGGAAGCCAAATTTTGGTCAATCGACCCAGGTCTCGCGCCTTCGAAATTGGTTACATACGGGACATCAAAAATGGTCGATTTGTGATACTTTATGAGAATGGAGAGGAAATAATGCACACCTTGGACCAATTGAGAGTATTCAATAAGTCACGTATATGTGACACGACAGATACAACGATATGGAAACCAGGCTTTATAGAGGCTGAACATCACACATACTTTCTGCAGCTTTACAGTTCTAATTCAGTTTGCTCCTTGCCAGACGAACCCGCCTATCTGGGCTGTTTCCGTGACAATATTCCCAGAGATCTTCAGGTATACATTCCCACTCGCCCAGCCACAATCGGCGCATGCGTGGATACTTGCAAGTCTCAAGGCTTCAGTATCGGAGCATTACGTAATTCCGATCTGTGCTTCTGTGGAAATTCCTACAGCAAATCCAATCAAGTTGAAGAAAAGGCGTGTGACATGCCTTGTTATGATAACTCATATGAAGTCTGTGGTGGATTCATGACATTTTCCCAGTATTGGACGGGAATTGTGGATTCGCCAACCCAACGTCAGCCTCAATCCGGACTGCAGAAACACTTAATTCCCTCAAACCATCCCATTCCTTGGGAGTTGCTGATGCACGCTCGAGCAAAATACCCATCACGCTACGCAACCGGATCAGCACGAAGCATGGCCTGGTACAAAACCCATCCATGGAATAGAAAAGGAAAGCTTGCTGCGTCATTTCAGCAAAAACGACCCAACGGGCTACAAAGTTATCCTGCTATTTATCGCGGTAAAGCACTGTACGCTCCAGATGCCTATCAGCGCTATAGACAATACTACGGATCGAAAGCATCTTATGCTCCTTATCGACAAGTGCCTTACAAGTGGCCTTACAATAACGATTACAAGAACAGAAACTACAACCTTCAGAGCAGTGCAATGGCCAAACATTTAAGTGGTTATCAAAGTTTTTATCAGAGAGGAGCCTCACCCCAGGAAAATGCCATGTTAATGAGTGCTTTGAGGAGGATCGGGAAACATCTTTTCAGCCACATCACCGGAAAACCTGTAGATTTAAGTTCCCCGCGATTCATGGGATGTTTTCAGGATTCCGCAGCTCGTGACCTTCCCACAGAAATTGACGTGAGACCGCTGACTGTCGAAGGTTGCGTTTTCAAGTGCGGGCGATTGGGGTTCTCCATGGCTGGCGTCCAGTCCTCTTCGCTATGCTTCTGCGGCACGACGTACAGTAGATACGGCAGGCTCAGAAATGAGCAGTGTAACATGCGTTGCACAGGAAATTACAAGGAAATTTGCGGTGGATTTTTGAGGAGTTCGTTATATTACACAGGCGTTGGCCAGGCCATCCCGTACTTCACAAAATTTGGTCCAAGGACTCAAAAGATAACCTTTATCAAAAATGATTTGTTAAAAGTGCATACAAACACGAAACAAGACCAAAATACAAAAGAGTTTAAGCCAATGAAAGACTCTTCCCAAAAGACGACGGTCAAGGTTCCCAACAACAAAGAGAAATCTGATCAGAAAATGGTGAACCAGGCCAAAGACGAAAATGACAAAGACAAGGGAAAGCCCATAACAATTGAAGATTACGGAAAGCTGACACAGATCCTACAAACACTTTCAAGATGGCAACAAAAAGCACCTGAGTTGCACCACAGTGATGGTGAACTTAGCAAAAAGCCCCTTCCGCACTACCAAGAACTTAGGAAGGTACTCAAAGAATTGACTCCAGAAATCGTGAAAGACGTCGCTACTAAAATAATGGCTGCTGAGTTGAACAAGACAAGGCTAAGGGATATGAAACCCTTAAAAGCAGTTCACAGTTTAGAGGTCAATATGGCAGCCTCAAGAGGAGAAAAAAGAAAATATACTGGAGTCAAACGGGTGAAGGTTCACACTTATAAAAATTGGAGCAAAAAGAATCGAAAAGGAAAGAACCAACATGGAGATATTATTTTGAAAGCAGGAGCTAAGGTTACCAGTTCAGCGAAACACGCTCCAACAATCAAACGAACCCCTCTCAAAAATGCCGGCACAGCTGATGCAAGCCAGGTGCTGTCAAAAAACGCGATTCAATCACTTCACGAGGCGCAATCCGTAAAAAATACAAAAACTTCTTCACCACTTTCAATCGCCGACAAGGGAAAGTATGCTTCCAAGAATGCGAGTGAGAAATCAAAGGCATCTGCAAAGGGCACCGCCAAGTCGAAGGATCGGCTCAAAAAGCTCGCTTCCGTGCACTCCATTGTAAGCGAGAGTAAAAACAACAAGAAAATGGAAATACCGAAGTCCAAAGTTGAACCATCTGGGAATCAAAGACAATCCAACAAGACAGAGTACACAGGAGGGTACTCTCATTCCCAGGTAAAGGAAACTTCCCCCGGAAAAAATGGGACAAAAATGAATGGCACAAGAAGTGACTTGACGCCAACTGCTTCGAAGCCCATACAGGATGTCGAGGAAGTCTTCGAAACATTTGGCACTCCTTCAAATGACGCCGATGTCAAAAACTCTAGAACGAATCTAAAGAAAACTGCGGTAAAAAAATTGAAGAAAGTTCCTCAGGAAATAAGCGTTCAACATAAACATAAAGTTCTTCACGTGGAGGCCAAATGGAAAGGGCAAATTAATGTAAAAGCAAACTGGAAAGATGACGATGAGACTGACCTTGAAACAAAGCATAAACATAATTCTCTTATGACGAAAAGTCAAATAAAACCAACTAAAACTGCAACGAATATAGAATCGGAGCGAAGCGGAGAGGAGGATGGTGAGGAGTATAATTTTGACGACAGCGGCTCAAGAAATGATCTCATCTGGAGGAATAGGAGATTAAAGAGAAAAGTGGAAAACAAATCGAAAAGTAAACCGTGA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009015 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01822 all species →	WSC	WSC domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002889 all species →	Domain	Carbohydrate-binding WSC	Interproscan
IPR051836 all species →	Family	Kremen receptor	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24269 all species →	KREMEN PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074615519.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074615519.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

50TPM > 0

2Conditions

9.3Max TPM

2.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	27	1.58	5.85
all_coral_tissue · baseline	38	23	3.14	9.35

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.85
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.60
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.85
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.65
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.46
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.16
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.00
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.96
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.92
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.91
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.71
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.67
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.57
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.43
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.41
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.34
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.32
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.14
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.05
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.79
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.59
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.50
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.48
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.44
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.14
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.97
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.93
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.35
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.87
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.97
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.85
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.42
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.39
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.21
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.01
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.93
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.87
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.56
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.54
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.30
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.07
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.44
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.21
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.14
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.86
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.51
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.43
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.62
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.97
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.85
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.