Gene detail

Detailed information of XP_074615982.1 in Acropora palmata

Genomic Location: NC_133884.1:17724207...17749740
NR annotation: XP_029205303.2, LOW QUALITY PROTEIN: protein FAM13B-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074615982.1

ATGGCAAAAATGAAAAAGAAAATCAGTTCACCTCTTCTGAAAAGAAAGAATATAAGTAGTGGTGTGGTGGTGTTGTCAAATAAGACATTTGGAGTATCGATTGATGAATTACTGAGAAAAACTGAAGGATGCGATGTGCCGCCCATTGTTACAACCATTGTGGAATTCCTTGAAAAAAATGGTTTGAACCAAGAAGGAATATTCCGTATTAGTGGTAACCACAAAGTGGTAGAATCCATAAAAGCATCATTTGATAAAGATGGTGAGGCCGACTTGGAACAAGTTGGAGATGTTATGGCTGTGGCTGGTCTTCTCAAGCTGTTTTTGAGAGAACTTCCAGAACCACTCATCCCACAGAATATGACAGCAGACTTCATAGAAATTCATAAAGCTCATAAAAATAATCATAGTGGTCTGATGGAGATGAAGTCACTGATTGAAAAACTGCCAGCATCAAGTTATCAGTTGCTGAAGTATCTTTGCAAATTCCTTGTGAGGGTTTCAATGAATGAAGAAAACAATAAAATGAGCTGCAATGCTTTGGCTATAGTATTTGGACCTAATGTCTTCAGGTGTAAAGATGACATTGAAGGACTACATGAACAAGGCCAAACTAATGCAATTGTTTGCAAGTTCATTCAAGAATTCGACACCTTGTTTGAGGTGTCTCCTTATGCTTCCACTGACATATTCAGAGTTCAGGAAGCCAAGAAAGATGCAATATTCATCAGGAGAAACAAGTACCCTGAAAAGGTGGAAAATGAGAAACTATTTACCTCTGCCATTGATAAGGGACCCCAGCATTGGACTGGAGAAAACGACAAGACAAATCCTCGCAAGGATGATGGTCCTATCTATGCAACTGTCAAAAAGCCTAAAAACTCCTTACATCCTCTCTCAATCATTTCCTCGTCTTCAGAAGACCTTGATATGTATGTACGGTCTGTGTCACCCTCATGGAATTCACAGTCCAGTGATGCTGTTCATGCTCAGGAATCTTCAAAGCCTGTTGTTGGCAAAGAGATTGTTCAAAAAGTGATCAATGACACCATCAAAGAACACTTGTTTGGACCAGACATGACGTCAACTGATGAGAACAGCCCACACTCACCGGAGTCTGGTGAAGAAGGTCCACCTCTCCCTAGTCGGGATTATGGTGAGAATGAAACTGTCAAGCCGAAGCGACGACGTAGGAAAAATCCTAAAAGTCTAAGGGAGCAATCAGGGCTCTGTGAAACAGGTGAAAACATTGAACCTGAAGAGACACGCGGGAATGACCTTGAACAGAATAAGGTCAACCTAAGACAGCACGACAAAGGACAACTTACAAGACTTAATAAGAAACGCCCTAAGTCCGAGGGATACCAGATATTTGAAAATATTGTAAGGCTGGATAAGAACAGCAACAACATACTGGGATCAACTTATCCCATCAACAAAAGTAGCTCGTCACGAAGTCACGATGACTTGTCACTGGAGAATGCTGGGTTGGACAAGGTGTTAAACAAAAGCAATGTTAATGACGATGTGCTGTCCTCAGTGAAGAGGAACTCTACTATACTTAAATCTTTAACTCAAGGCCGGGCACCTCCACCCAAAAACAGACGCAGACCTAGCTTCGGCAAATCATGCGATGCTGTTGCGAGCGAAGAAGACGATTCCGACAAGAGGCAACGTAAGCGGTTGGTTCACCCATTAGTCGATGATGTGAAGAGTAAAAATGTAGTGAGAACAACACCGCCAAAATCACCCAGGTCATCAAGGTCGTCGAAACTTCAAGCTCCTTCCTCTTCGCCCAAACCAGAGAGAGATGTGGATGAGGTTGATGCAGCTGCCTCTAAACCCAAGAGAGAGAATCTTACCAAACACTACAAGACGAAACACCATAGCGCACCAGCAGTGCCTCCCTTGGAGCTCTACAAGCTTCAGCAGGATGATTCAATTCCAGACATTATACAGCTTTCACCTAGGGAGCGATACGATGGGCTCAACACAGATGAAGCATTGGTGTCCCCTCGCATTCGACCCCTGACTATTGATACCCGAGCTATACCTCACGAGTGTCCTCCATCACCACCACATGAACAGATAGAGCATGTGTGGTTTGAAAGAAGGGTTGACTCCTCTCCCAAAGGTGAACCAACAATGAAGCAACTCACAAAGATAATCTGTCAACTAAAGAAAAAAATCCGCGATTTTGAAGATGCATTCGAAGATGAACACTGTAGGAGGCCATTACAAACTGAAAAGGCGCCCATCAAGAAATACGTAGCTGAACTCGGGCGAGCTAGGAAACAACTGAGAGAATTGAAAGAGCGAGCCAAGGACGAAGTTGAACGTCTGAATGAGACAGTACCTCCAATGAACATTGGTCAAAGTATGAAAGGAAGCCGCAGTGAGCCGCTACTGACAATCACACCTTCCAGCATAGAGGATTCTCTGGAAAGGTTACTGCACCAGTTGGACGAGAAGAGAGGGGAGGGTGGTAGACCAGAGGAGGTAGAGCTAATGTTACGAGAGCAACTTCAGGATGAAAAGCTGGCAGTACAGAAAGCACTGTTGCTACACGAGAGTTTGTTTGGTCGGCCAAATACTAAGAAGGATAAGGATATCATGAGACCTTTGTATGACAGGTATCGCACAATCAAACGCAAGCTCGCTGCATCTGTCTCCGAACCAGCGATCAAAGTATCTAGTGGTGGTCGCCCTCGGACCAGTTCAATTGACAGATTGGTGTCAGATTTGGCGCCAATTCACGAAGATGCCCTATTACACTCGCCTAGTGAAGCAGCGAGCTCTCCAGCTCGATTCACACAGTCTCTCCCAATCACATCTGGAAGAAGCTCTCCTAGAAGTCGCTTATCAGGTAAAACTCTGGAGACAGCACCTACAGATACACAAGATAGTGACAATGAGGGATTCAATGACACGATACAGGATACTTTCAGCATCGGCACAACTGTTGCTCAGCTCAGAGAGGATGACAAGTTCCATACGATGTCACGAGAGGAACTCAACGAACAACTTGAGTTAAAAAGAAAAGAGAAAAAGAAAATGAGGAAGATACTCAAGAAATTTGAAGATGACTTCTTTGAGGAAACAGGACGGCGTGTCCAGAGAGAAGATAGAGGTGACATGGAACCTGATTACCACGAGTATAAGCACATCAAACACCAGTTAAAGCTCATCGAGGCTTTATTAGCCAAGCGAAAAGCAAGCAACACGCTGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O94988	Protein FAM13A OS=Homo sapiens OX=9606 GN=FAM13A PE=1 SV=2
Q8BGI4	Protein FAM13A OS=Mus musculus OX=10090 GN=Fam13a PE=1 SV=1
Q8HYW0	Protein FAM13A OS=Bos taurus OX=9913 GN=FAM13A PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002775 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00620 all species →	RhoGAP	RhoGAP domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008936 all species →	Homologous_superfamily	Rho GTPase activation protein	Interproscan
IPR000198 all species →	Domain	Rho GTPase-activating protein domain	Interproscan
IPR039102 all species →	Family	Protein FAM13	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15904 all species →	FAM13	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007165 all species →	Biological Process	signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074615982.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074615982.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

79TPM > 0

2Conditions

94.9Max TPM

53.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	44	53.61	81.10
all_coral_tissue · baseline	38	35	52.36	94.89

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	81.10
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.01
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	73.10
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	71.22
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	69.36
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	69.07
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	68.90
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	67.97
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	67.17
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.12
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	64.71
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	62.90
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.66
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.76
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.23
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	59.12
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	58.68
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.85
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.84
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.47
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.79
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.51
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.40
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.82
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.81
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.37
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.09
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.48
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.24
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.67
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.48
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.30
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.93
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.57
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.59
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.61
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.98
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.71
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.53
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.61
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.01
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.83
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.97
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.37
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	94.89
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	85.04
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.91
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	67.90
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	67.34
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.39
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.19
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.32
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.19
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	59.87
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.44
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.72
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.27
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.75
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.05
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.21
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.92
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.57
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.20
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.19
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.19
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.92
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.31
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.90
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.89
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.54
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.03
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.93
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.91
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.24
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.89
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.67
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.22
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.11
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.48
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.