Gene detail

Detailed information of XP_074616062.1 in Acropora palmata

Genomic Location: NC_133884.1:9931439...9947182
NR annotation: XP_044169062.1, cleavage and polyadenylation specificity factor subunit 2-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074616062.1

ATGACGTCAATAATAAAATTGACAGTTCTTTCCGGGGCATATGATGAGGGGCCACTATGTTATTTGCTTCAAGTAGATGAGTTTCGATTCCTTCTTGACTGCGGCTGGGACGAGACTTTTAGTGAAGACGTTATCAAGCCAGTTAAAAAGCTTGTTCATCAAATAGATGCTGTACTTATCACGTTTCCTGATATCTATCATATGGGTGCGTTGCCGTATCTTGTGGGAAAGTGTGGTCTGCATTGTCCTATCTATACAACTATTCCTGTCTACAAAATGGGCCAGATGTTTATGTATGATTTGTACCAGTCTCATCAAAACTATGAGGACTTTGAAGTTTTCAGTCTTGATGATGTTGATGCTGCTTTCGATAAAATCATCCAACTCAAGTATTCTCAAAATGTCAGCTTGAAAGGAAAGGGTCATGGTCTGATGATTACTCCTTACGCTGCTGGACACATGATTGGAGGCACGATGTGGAAAGTTGTTAAAGATGGAGAAGAAGATATTATTTATGCTGTAGACTACAATCATAAGAAGGAGAGACATTTGAATGGAGCAGTTTTGGAAACACTCAGCAGGCCTTCCCTCCTCATAACAGACAGTTTTAATGCTTTAAATGTTCAAGCAAGAAGAAGAGAAAGAGATACACAGCTTATGACTGAGATGTTAAACACGACAAGAAGAGATGGAAATGTTTTGATTGCAGTTGATACGGCTGGAAGAGTTTTGGAGTTATCACAACTCTTGGATCAGTTGTGGCGTAATTCTGAGTCTGGATTATCAGCATATTCCCTTGCAATGCTGAACAATGTCAGTTATAATGTTGTGGAATTTGCCAAGTCACAGGTGGAGTGGATGAGTGATAAAGTCATGAAATCTTTTGAGATTGGAAGAATGAACCCTTATCAATTCAGGTACTGCACCTTATGCCACAGTCTGGCTGATCTTGCTAGAGTTCCAGATCCAAAGGTTGTTCTAGCATCTGTTGCAGACCTGACATGTGGTTTTTCAAGAGAGCTCTTCATCAAGTGGGCAGAGGAACCAAAAAATACTGTAGTATTCACCTGCCGTCCCTCTCCTGGAACCTTAGCCCGTTCCTTGATTGACAACTTGCAGCAGAAGACAGTCGACATTGAGGTGAAAACAAGAGTGAAGCTAGAAGGAGATGAGCTCGAGAGGTACCTGGAAGAAGAAAAGGAAAAAGAGAAGAATAGACAAGTCAATGAAGCGACTGAGAGGAGTCATTTGACAGCAGAAGAGAGTGACAGTGACAGCGATGAAGATTTAGAAGGAGGAGTAAGGCATGATCTCATGATGGCTGATGAAAAGGGTGGACGCAAAAGCACCTTTTTCAAACAGGCTAGGTCATATCCCATGTTCCCGTGTCATGAAGAGAAAATTAAATGGGATGATTACGGAGAGTTCATCAGACCAGAGGATTTTATGATCAGGGAGTTAGCAGCAGCGGAGGAAGAAAAAGCCAAAGTGGAACAAAGTAAAAAAGAAGCCGCCAATACAGAAGCTATAGCGGGACATGCTGAAATGTCAAAAATTCCGACAAAGTGTGTTGTGGAGAAAAAGCAGCTCAACATCAGATGTTCGTTGTTGTACATCGACTTCGAAGGGCGATCAGATGGCGAGTCGATCAAGAGAATTCTTTCCCTTGTCAATCCAAGAAACCTCATTTTGGTGCACGGCGTGGAAGAAGCCACGGATCATCTTGCTGAATACTGCCGACAGAATACTAGTATACAGGTGAATCAGGTGTTTACACCGCGCTCCGGCGAGACAGTAGATTCGACTGGTGAAAGGTATATTTATCAGGTCAAGCTGCGTGACGCGCTGGTGAGCTCTTTGCAATTTTCTCGCGCCCGTGACGCAGAACTCGCGTGGGTGGACGGACAGCTGCATATGAACTCCTCCGAGTCCCACGTGGGGCTGGTGCTGGAAGATGGAGAGTTACGTGACGAGGAAGAGGGTCATGAGAAAATGGAAACTAATCAGAGCAATGAAAATGGCAAGGAAGAACCAATGGACACTGTCCCCGTTTTGGAACAGCTGCAGTTGTCACAGATCACTGGACACACCTTGGTTTACATAAACGAACCCCGTCTGTCGGATTTCAAGCAGGTTTTGAACAAAGCTGGGATCCAAGCGGAATTTGCCGGCGGTGTCTTGATTTGCAACAATAACGTTGCGGTTAGAAGGAACGAGACTGGCCTAGTGGGTCTGGAAGGAGCCGTGTGTGATGACTACTACAAGATCCGGGAACTATTGTACGAGCAATATGCAGTGGTGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q10568	Cleavage and polyadenylation specificity factor subunit 2 OS=Bos taurus OX=9913 GN=CPSF2 PE=1 SV=1
O35218	Cleavage and polyadenylation specificity factor subunit 2 OS=Mus musculus OX=10090 GN=Cpsf2 PE=1 SV=1
Q9P2I0	Cleavage and polyadenylation specificity factor subunit 2 OS=Homo sapiens OX=9606 GN=CPSF2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004930 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10996 all species →	Beta-Casp	Beta-Casp domain	Domain	Interproscan
PF07521 all species →	RMMBL	Zn-dependent metallo-hydrolase RNA specificity domain	Motif	Interproscan
PF16661 all species →	Lactamase_B_6	Metallo-beta-lactamase superfamily domain	Domain	Interproscan
PF13299 all species →	CPSF100_C	Cleavage and polyadenylation factor 2 C-terminal	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR022712 all species →	Domain	Beta-Casp domain	Interproscan
IPR011108 all species →	Domain	Zn-dependent metallo-hydrolase, RNA specificity domain	Interproscan
IPR035639 all species →	Domain	CPSF2, metallo-hydrolase domain	Interproscan
IPR027075 all species →	Family	Cleavage and polyadenylation specificity factor subunit 2	Interproscan
IPR036866 all species →	Homologous_superfamily	Ribonuclease Z/Hydroxyacylglutathione hydrolase-like	Interproscan
IPR001279 all species →	Domain	Metallo-beta-lactamase	Interproscan
IPR025069 all species →	Domain	Cleavage and polyadenylation specificity factor 2, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45922 all species →	CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR SUBUNIT 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0005847 all species →	Cellular Component	mRNA cleavage and polyadenylation specificity factor complex	Interproscan
GO:0006378 all species →	Biological Process	obsolete mRNA polyadenylation	Interproscan
GO:0006398 all species →	Biological Process	mRNA 3'-end processing by stem-loop binding and cleavage	Interproscan
GO:0098789 all species →	Biological Process	obsolete pre-mRNA cleavage required for polyadenylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14402	CPSF2, CFT2; cleavage and polyadenylation specificity factor subunit 2	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074616062.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

69TPM > 0

2Conditions

34.5Max TPM

13.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	38	11.52	26.78
all_coral_tissue · baseline	38	31	15.46	34.53

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.78
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.04
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.00
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.14
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.69
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.64
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.05
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.00
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.72
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.04
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.17
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.12
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.11
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.97
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.78
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.77
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.04
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.46
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.39
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.82
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.06
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.96
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.90
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.77
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.60
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.47
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.40
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.22
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.93
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.90
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.61
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.37
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.73
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.52
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.12
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.86
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.71
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.53
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.12
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.26
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.11
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.62
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.25
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.17
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.46
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.71
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.44
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.44
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.36
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.68
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.66
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.15
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.86
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.64
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.03
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.35
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.16
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.57
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.26
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.54
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.50
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.11
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.83
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.09
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.02
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.90
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.97
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.78
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.