Gene detail

Detailed information of XP_074616293.1 in Acropora palmata

Genomic Location: NC_133882.1:7824649...7858106
NR annotation: XP_044162892.1, C-myc promoter-binding protein-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074616293.1

ATGGTTGACCGTGAAAAGCCCCAGCGTGTTGCTGATTACTTTGTCATAGCCGGTCTGGGAAATGGCACGTCCTCTAATGATGCTATCCAGTTTGACGTGGACAGAAATAATTTGGAGCCGATTACTGATGTAACTGTGATATTCAAAAGTTTGGGAGAGCAACCTCCGAAAGGCTTTACCTGCATTGAGAAAACACCGGCAGGCTTTCCTGCCAACCTAAACCATGGCTCCATCAGACAGCCATCATGCTTTCTGTGTTTTCGTAGAGGGACTGACAAGCCACCACTGACTGACATTGGAGTCCTTTATGCAGGAAAGGAAAGGCTGATGTATGGATGTGACTTTGTTTATGACACGCCATCGGGAAAAGAAGCCAATGTCAATAACAGCACCAACAGTAAAACATTTATCACTTATCGGCGTGCTCGACAAAAGATGGCTCACTCATCCCTGGCGGTCACTGAGATTTGCATCATCATAGCTAGCAAGAGTGAAAAGCCCCCTCATGCATTTTGCTTGATTGAGAAGAATCTTAACAAAGGGATGGTTGGCTCTGATGTTTACATCTGTTACAGAAAATCTCTTGCTAGACCACGCTCTATTGCTTATCCTGCAGAGGTGCTGAGTCGGTTTCCTGTGGATGATTATGAAGGATTTCCACTTCCAGACACAATTCCGATGTTTTGTCTTCCACAAGGAGCAACTATTGAGTGCTGGCCAGAAAACTCTCCATATCCATTACCTTCTTTCTCTACTTTTGTTCTCACTGGAGCATCTGGCCAAAAAATCTATGGAGCTGCCGTTTCTTTTTTCGAAGTTTTGCCTGAAGAGCAACTTACAGAAGAAAGGAAAAAAGCTTTGCAATTGAATGATGAAAGAAATTTTGAAGAAGAAAGGAAAGTTCCCCACACAAATAAGTGCATTTGTGTCTTGTCTCACTGGCCATTTTTTGAAGCTTTTAAGAAGTTCTTATCTCATCTTTATCGCATTTCTATATCAGCTCAGCAACATCCCATTGAAAGGTACATAGCAATTTTGATGCTTGATGTTCCATTCCCATCACCTCAGAGACCTCGCATTCTTGTTCAGACAAGCATATATGATCCTTTTGAAATCTGCCAGCCCTATCACACACCTCTGCCAGTCAGTGGTGCATCCTACACAGCCATGCTTCGTTACCTTGGTCCTGACCATGCTATGCTCTTGTTTTACCTAATTCTTACGGAACATAAAATACTTATCCATTCTTTGAGGACTGAACTTATGACCAGCATCGCAGAAGCTATTACGACACTACTGTTTCCATTCAGTTGGCAGTGTCCCTATGTCCCTCTTTGTCCATTAGGCTTAAGTGATGTGCTTGATGCTCCTTGTCCTTTTGTTGTTGGCATTGATTCACGCTACTTTGATCAGTATGACCCCCCTGATGATGTGACATCGGTGGATTTGGATACAAATATGATTTTAGTAGAAAATGAGCTGAAAGGAATAAGCTGGAAAGCCCTTCCAAAGAAACCAGGAAAAGTATTGGAAGAGAAACTGAACAAGCTTCATTATCAACTGTATCAGCTCTATAGCAAAGAAAGAGATACAAGTGGTGGTGATACATGTATCACTGAAACAGCCATTCAACTTGCTCCTCTTGATTATGAAAATTCACACTCAAGGAAATGGCTTCAAATAGAGGTGGCAATTCAAGAAGCATTCCTAAGATTCATGGCCACAATCCTCAAAGGCTATGAGCAGTTCTTAAAACCGATTACCTCTGCCCCAACTCGGGAGACATGTGATTTGACTTCATTGTTTGATCTTGAGGGGTTCCTCAGAAGTCGCCCCAGTTCTCAGTCAAAGTTTTTCCAGACTTTAACAAGAACACAGATGTTCAGCCGGTTTATTGAACAACGATCCTTTGTGACGTCACAAGACTCGCTGCTGGCGTTTTTCGACAATTGTTTGGAGAAGCTTGATCAGTCGCCTGATGCACCACTCATTGAAGTTGATGACTCTCTCACTAGGGGTGGACAGAGGACTTACGTAGTTACTCCCCCTGAGTCCAACATGGACAAGGGAAAGCTTTACACGTATGATGCATTTCCAAGTGTGAACGTTGAACTCGTGAAGCTGAAGGAGCCTTTGCACACGCAGTCCATAATGACCCCTCCCGTGTCCCCTGTCGTAAAACGAACAAAAGCAGAGAGGCACCGTTCTGTGCTGATGGCAAAGAAGAATTCAGCAAGTCCTATCAACTGGGCTAAATGTTTGTTGGCTCATTGTTACAGCCTTTGGTTTATTCATCTTCCTGCATATGTCAAAATTCATCACAATAAGGCCAAAGTGTTACACGTGGCATATGAGATCTTGTGCAAAATGCAAACTAAGGGCGTTAAATTACCAGATGAGGTGTGTTACAGAGTTCTGATGCAACTGTGTGGACAGTATGGACATCCAGCGCTTGCTGTTAAGGTTTTGTTCGAGATGAAAAACCAAGGAATAACACCCAATGCTGTGACGTACGGATACTACAATCGGGCTGTGATAGAAGGAAAGTGGCCATCGAACTCAACAAGCTCGCACATGTGGAATAAACTGAGGAATTTCTTTGCTGCTGTGTACGAGCTTCAAAGACTCGCTAGACTCAGCCGCGGCAAAGAAGATTCGTTATCGCCATCGGGATCAAGTGGCGACTTGGATCTCAGTGACTCACCAAGAAGGACATTGAAGAAGCCAGATAGGTCACGCACTCCATCACGCGAACGTGAAAAATCTTTGTCACGCGAGCGTTTGCTTGAGGATCGAACGGAAAATGGAGGCCGGAGCACGCCTGAAAGGGAATTGAAACCTAGTCGCCAACGAACAATCAGTGAAATGTCCACAACGTCCCAAGCCTCCGCGGATATTTTAAATCTATCCACTACATCGATTGATGGCCCAGCGATATCCTCCGGCACCAAGCTACAACGCTCAGCTTACCGCAGAACAATCAGTGAAACGTCGGTTTTATCAGCCACGCATTCGGAGCTGTTTATCAACGCAGATAGCGAGGATTCTGATCCGTACGTGTACACGACTAGTAGGCTGGATGAGGTGATCTTTGGACTACCGGCTGGTCTCCAACCCGACACCGCGCTGGAAGCTGTGATGTGTACCTGTCATCAGTGTGTCAAATGTGGCAGATATTTGTATGATGAAGACATCTTAGCTGGTTGGACCGCGGACGACTCCAATCTCAATACAGGGTGCCCGTACTGCCAAACCCAACAGGTGGCGAGCCTCACCATAAAAATCAAGGATTATAGAAACTGCTTCTCATCGCATCCCAGTTCAGAGTTATCGGCCAGCATCAACAGCTTCGGTAGTTCGGAACTGCTACCAGCCGAAACCGAAGATGAACCGAAGCCGGGTGCTCTCAGCAATTCCTTCCCGTCTACAATCGAATCCAGTGCGTCGATGCAGAAATTTAACAGTCTCCCTCGTGCGTCGCCTCCGTCATCAAACCCAGTCCCCATTCGAGGAAGTCATCATCGCATGCGTCACAGCATCAGTGCGCCATCTAGCGCATCTGGCAGTCCCTCTGGGAGCCTTCACGGGAGTCCAAACCCGGGGTCCTGGTTCCAGCGCACGCGCAGTAGTAATAGCACTTGCAGTCATGGTAGCAGTTGGTATGTTTCCAGAGCTCCGGAAGAAAGAGAAAATATTAACGTGCCCTATCTGAATCCTTTGGTGCTTCGAAAGGAACTTGAAAATATGTTTGAAAATGACGGAATAGACACTCTTCAGTCCCCTGATGTAGTCCAGGAGAAAAGGATCATATTTTGGAACCTGGTGTGGTATTTCAAGAGGCTGGACCTGCCATCACATTTAGCAAGCCACGTGCTCTTAACCTATCCCAGCAATGAAAGGCCTGATAAAGCTGAGGATCGGCGCAGTATTTCAGGGCTTGGTACCCAGGTGCTTGTGTCCACTTCGTGGGACGGGGAACGCGAAGAACATGACGTGGTTCCATTATATATCCTCTGGAATGCGCCAGCGGACCAGCAAGGTTCCTTAATGGACAAAGGCCTGACAACAAGAAGCGTGATGCAGTCAGTGGTAGCTCATATTCAGGCAAATGATGTTCTAAACCCGACTATTATCCTCTTGGAGGAGCGAAGTCGACAAAAAAACGTTAACCCAAACGCAAAATGGAGCGTTTATCGAGAACTGCTGTTCCTAACTCTAACTGCTTGTGGAGCGGAAAACATAGACATTGATGCTTTCGACAAAGAATACAGGCGGGCATACTCTCGATTACGTGAAACGAACCAATACTCGGATCTGTTGTGTCCTGAGGACAAATATCCGCTGACCCGAGTAATCTATTGTAGGCGCACATTTGATCCCCTAACCCTTCAACCCAGGCTTCCGCAGTACCTCTTCAACACCTTTGCCTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7Z401	C-myc promoter-binding protein OS=Homo sapiens OX=9606 GN=DENND4A PE=1 SV=2
Q5VZ89	DENN domain-containing protein 4C OS=Homo sapiens OX=9606 GN=DENND4C PE=1 SV=3
A6H8H2	DENN domain-containing protein 4C OS=Mus musculus OX=10090 GN=Dennd4c PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003081 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13041 all species →	PPR_2	PPR repeat family	Repeat	Interproscan
PF03455 all species →	dDENN	dDENN domain	Domain	Interproscan
PF02141 all species →	DENN	DENN (AEX-3) domain	Family	Interproscan
PF10240 all species →	DUF2464	Multivesicular body subunit 12	Family	Interproscan
PF03456 all species →	uDENN	uDENN domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR043153 all species →	Homologous_superfamily	DENN domain, C-terminal lobe	Interproscan
IPR002885 all species →	Repeat	Pentatricopeptide repeat	Interproscan
IPR005112 all species →	Domain	dDENN domain	Interproscan
IPR023341 all species →	Domain	MABP domain	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR001194 all species →	Domain	cDENN domain	Interproscan
IPR018798 all species →	Family	Multivesicular body subunit 12	Interproscan
IPR005113 all species →	Domain	uDENN domain	Interproscan
IPR037516 all species →	Domain	Tripartite DENN domain	Interproscan
IPR051696 all species →	Family	DENN Domain-Containing GEFs	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12296 all species →	DENN DOMAIN-CONTAINING PROTEIN 4	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000813 all species →	Cellular Component	ESCRT I complex	Interproscan
GO:0031410 all species →	Cellular Component	cytoplasmic vesicle	Interproscan
GO:0032483 all species →	Biological Process	regulation of Rab protein signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20163	DENND4; DENN domain-containing protein 4	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074616293.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

70TPM > 0

2Conditions

40.3Max TPM

20.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	36	17.78	38.27
all_coral_tissue · baseline	38	34	24.13	40.31

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.27
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.16
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.99
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.53
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.07
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.24
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.05
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.96
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.69
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.86
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.14
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.52
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.19
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.43
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.86
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.82
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.55
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.83
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.08
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.83
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.79
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.37
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.71
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.57
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.90
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.84
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.86
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.56
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.05
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.75
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.71
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.53
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.26
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.30
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.07
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.57
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.31
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.88
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.58
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.56
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.47
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.23
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.73
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.05
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.95
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.66
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.47
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.37
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.57
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.56
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.00
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.76
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.51
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.74
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.58
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.21
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.05
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.84
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.05
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.98
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.15
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.05
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.31
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.26
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.05
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.45
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.11
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.66
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.80
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.87
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.