Gene detail

Detailed information of XP_074616489.1 in Acropora palmata

Genomic Location: NC_133884.1:12794011...12810693
NR annotation: XP_015780934.1, PREDICTED: ranBP-type and C3HC4-type zinc finger-containing protein 1-like [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074616489.1

ATGGCTCAACACCAGTCAATAGGCCCCGCGGAACAAGTGCTTGTAGAATTCCGGGCAGTGGTGTTCTTGTATGATAGTCAAGTTAGCAGATGGAGCGAAGTAGGAGAATCGAATGTGTGCTCGCGAGTTTTCCTCATATCAACTCGACCTTTCGGAAGTATGGGCTGTTACAGAATATTCGGAAGACTGGAATCTACTGGACATGTAACACTTAATTCAATCCTGACTGACAAAGATGAATATGTGGTATCGAATACTAAGTGGCATCAGATGCGGACTGCAACAGGAATATGTTATGGATTTGGTGTTCTCAGCGAATCAGAAGGTTCTAGATTTTCTGTTATAATTCAGCACACTCTGCGATCTTTGCAAGGTACTCAAACTCAGTCGCATCAATCACAAGCACACCAATCACAATTGGCACCTGATGCAAAGGGAACTGGTCGAGTGAGCCCAAATCTGAAACCACCCAATCCAACTCAAAGAGTGCCAGACTCTCCTGGCCAGGATGGAAATCAGACACAAAGAAAACGAGACTTTGATGTGCAGATTGATTCCTTTTGTGCAGCACTAAGTGAAGCTATCATGAATGGAAAACAAGAGCAAGCTGTAGAAATTACCAAAAAACTGACCTCACAGAAAGTGAACTTGAGCATTAAACTTAAAAATCCAAACCTTGTTACTATGGATGCTGGAGGAAACACAATTACTTTGCGAGTGGTTGTTGAGGATAAAGAGTCATCTGGAGGAACTTTCAGCATGAAAGTTTCTCCAACATGTACAATAGAGAAACTGCAGCAGGAGGTATTTGACAGGTTCGGTTTCCCTGTTCAAGTGCAAAAGTGGATTGTGGGCAAGAAAGTACCAAAACCGACAGACACATTACATGACCTTCTTGTACGGCAGTCTGGAGCCACAGTGTTTTTGTATCTCTTATCTGGAAAGACAGTTGGTTTACGGCAATCTGATGTTGAACAACTTGTTCGCGGTGATACCGCAACATCTAGTACTTTGCGAAGTAATGCTAGCTGTAGCAGTGCAGCCGCTACTTCTTCCACCTTTTCTTCCTCTTCTTCTACCACTTCAAATTTGAGGCAAGCTGTGAGCACTCCAAATCTCGCTGCTGGAAACGTTCCCCCGGCTTTTGGTGAAGTAAGCAGGGAAGAGCAAGTGCCTGAGCGAGGCTTTGCATCTCTTATGCCGCAGAGATTACCAGCACCAGCTGCAAACTGGCAAGACATCAGTGGCCCGGCAACATTCCATGTTGACCCAACCATGGACATTCGAACCCTACAAAATAAGCTTGCTCAGCAGGGCATGGCTCAACGGAGTGGGCCCGCAAGTCCTTCCAATCCCGCCGTTGAAGAAGTCGTTCTAAATAATATAGACCCAGAGGAGCAACAAGCAAGAGAGGGCTGGACCTGTGAAAGGTGTACTTTCGTTAACCAACCCACTAGGCCTGGGTGTGAAATTTGTGCTGCTGCCAGACCTGAAGGTTATGTTGTGCCGGTTGACACAATGTTGAATGAACAAGAGAGAAATAGACTTGCAGCGGAGCAAAGACAAGAAGCTCTGTTTCAACAGGCAGAACGGAAACGCCAACAAGAAGAGCAAGGTGCAAGACAGCGTAACTTGGCCACCATACTAGAAGCCGCACAACAAAACCTCATTCCCAATCAGGACGAGTTTGATTGTGGCATTTGCTTTACTCCTGTGGAACCTGGGGAGGGAGTAGTACTCAGGGAATGTCTGCACAGATTTTGCAGGGATTGTTTGAGCGAACACATCCGTCACGCTACAGACCCGGAAGTGCAGTGCCCTCACCAGGATGATGATTACGCTTGTCACGCAACCCTCACTGGACAAGAAATTAAAGCGTTGTTGTCAGAGGAAGATTTCAACAGGTTCTTGAACCGAAGTCTCGCAACTGCGGAGAGTCAAGCTGCCAATAGCTTCCACTGTAAAACTCCTAACTGTCAGGGGTGGTGTTTGTACGAGGATAATGTGAACACATTTCACTGTCCTGTGTGTCAACAACCCAACTGTCTGACTTGCAAAGCTATTCACGCTAATATGAACTGTAAAGAGTATCAAGATGACTTGAAACGGAGAGCGCAGAATGATGAGGCGGCGAAAAAGACTCAAGAGTATCTTGAGAGAATGGTTGCAGGTGGTGATGCTATGCACTGTCCGATGTGCAAGATCATCTTGGTAAAGAAGGACGGCTGTGATTGGATGAAGTGCAGTATGTGCAAAACGGAAATATGCTGGGCGACGAGAGGACCCCGATGGGGACCTGGAGGAAGTGGAGACGTGTCAGGGGGATGCAAGTGTCGCATCGGAGGAAAGAAATGTCACCCTAGATGCGGAAACTGTCACTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A9JTG5	RanBP-type and C3HC4-type zinc finger-containing protein 1 OS=Danio rerio OX=7955 GN=rbck1 PE=2 SV=1
Q62921	RanBP-type and C3HC4-type zinc finger-containing protein 1 OS=Rattus norvegicus OX=10116 GN=Rbck1 PE=1 SV=3
E6ZIJ1	RanBP-type and C3HC4-type zinc finger-containing protein 1 OS=Dicentrarchus labrax OX=13489 GN=rbck1 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003398 (this species only)
Ubiquitin family	UBD\|ZnF\|NZF · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 activity\|RBR · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00097 all species →	zf-C3HC4	Zinc finger, C3HC4 type (RING finger)	Domain	Interproscan
PF00240 all species →	ubiquitin	Ubiquitin family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR047558 all species →	Domain	Heme-oxidized IRP2 ubiquitin ligase 1, BRcat domain	Interproscan
IPR047557 all species →	Domain	Heme-oxidized IRP2 ubiquitin ligase 1, Rcat domain	Interproscan
IPR001876 all species →	Domain	Zinc finger, RanBP2-type	Interproscan
IPR018957 all species →	Domain	Zinc finger, C3HC4 RING-type	Interproscan
IPR036443 all species →	Homologous_superfamily	Zinc finger, RanBP2-type superfamily	Interproscan
IPR000626 all species →	Domain	Ubiquitin-like domain	Interproscan
IPR017907 all species →	Conserved_site	Zinc finger, RING-type, conserved site	Interproscan
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR044066 all species →	Domain	TRIAD supradomain	Interproscan
IPR047559 all species →	Domain	Heme-oxidized IRP2 ubiquitin ligase 1, modified RING finger, HC subclass	Interproscan
IPR029071 all species →	Homologous_superfamily	Ubiquitin-like domain superfamily	Interproscan
IPR051628 all species →	Family	Linear Ubiquitination-Associated E3 Ligases	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22770 all species →	UBIQUITIN CONJUGATING ENZYME 7 INTERACTING PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000151 all species →	Cellular Component	ubiquitin ligase complex	Interproscan
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0043130 all species →	Molecular Function	ubiquitin binding	Interproscan
GO:0043161 all species →	Biological Process	proteasome-mediated ubiquitin-dependent protein catabolic process	Interproscan
GO:0097039 all species →	Biological Process	protein linear polyubiquitination	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10630	RBCK1, HOIL1; RanBP-type and C3HC4-type zinc finger-containing protein 1	EC:2.3.2.31	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074616489.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

71TPM > 0

2Conditions

77.5Max TPM

35.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	37	29.57	76.76
all_coral_tissue · baseline	38	34	43.42	77.46

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.76
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	67.95
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.03
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.79
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	58.40
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.73
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.64
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.00
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.63
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.03
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.66
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.85
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.55
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.82
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.97
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.95
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.63
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.59
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.04
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.27
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.71
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.54
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.92
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.55
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.53
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.85
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.28
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.70
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.07
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.18
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.17
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.07
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.08
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.47
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.14
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.53
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.94
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	77.46
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	72.25
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	67.82
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.85
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	65.98
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.94
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.09
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	60.97
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	59.24
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.71
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.57
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.69
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.40
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.87
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.89
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.30
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.36
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.26
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.56
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.54
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.60
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.26
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.14
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.96
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.84
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.43
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.18
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.32
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.16
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.30
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.15
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.98
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.51
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.26
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.