Gene detail

Detailed information of XP_074616635.1 in Acropora palmata

Genomic Location: NC_133884.1:25884456...25911737
NR annotation: XP_029181821.2, protein bicaudal C homolog 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074616635.1

ATGAAGATGGCCACAGGTATCGAGTTATGCGAGGAACAAGGGGATATACTCGCTGATGATAACAATCAAGAACTCGATCCTAATGTTGTAGAGGAGAGATTTCGTGTGGATCGCCGTAAACTTGAGCAAATGTTACAAGCTTCCAAGGAAGGATGCGGACAGACGGGCGAAGAGTTTTTCCAGAAGATTATGGAAGAGACAGCAACCACGATCACTTGGCCCTCGAAACTCAAGATCGGAGCAAAATCAAAGAAAGATCCTCATATCAAGGTAGCAGGCCTACCTGAGTCTGTGCGTCAAGCAAAGGAGAAAATTATGGCTGTCTTGGATACAAAGTCAAGTAGAGTAACACTGAAAATGGATGTATCCCACACTGATCACTCCCACATCATTGGAAAAGGAGGAGGGAACATTAAACGAGTAATGCAGGACACAGGCTGTCATATTCACTTTCCTGACTCAAACAGAGGAGCCTCAAATGAAAAAAGCAATCAGGTGTCAATTGCTGGCCAACCTTTAGGTGTGGAAAGTGCACGGCAGCAGATCAGGGACTTACTTCCCTTGGTTCTTACCTTTGAAATACCACTGGGTGGAAGATTACCCTTGGATGCCAGTTCACCAGCTATTCAGCGCATAGCTCAAAGTTGTAATGTCACTATCAATTTTAAACAGAGACCAAGGGCTTGTAGCCAGATAGCAATTATCAGAGGTTCACAGCAACATGTTGGTGGTATAAAGGAAGCCATTTCTCATTTGGTGGAACATTTCACTGCTAAAGTAGCTTCTTCAGTTCCAGTGAATATGCAGATAGACATTGCACCTCAGCATCACTTGTTAATTATTGGAAGAAATGGCATCAACATCGCACAAATTAAACAACAGACAGGGGCAAAAATTTCATTTCCTGATCCCAATGGAACTCAAAGAAAGGGCACAGTTTTTATCTCTGGATCAGTGGAAGCTGTCATTACTGCTAGAGCACAGCTTGTTGATTGTCTCCCACTAGTACTGATGTTTGACCTGCGAGATGAAGATGAAGATGCAGATAATGCAAAATTGAATAAAATAATGGAGACCTATGATGTCTTTGTGAGTGTAAAACCAAAGCTTAAACAGCCAAGCAAGTCTGTCATTGTCAAGAGTGCAGAGAGAAACGTTCAAAATATGTATCTTGCAAGACTTGAAATCCTTGGTCTCGATACTAATGAAAACTTTGCTTCATCACCAACGTTTGTGGCATCAAAGCTGATCGATGGCGGTCATCATATCCCTTCCCACGACAATTTTACTCGAGAGTACTTCGGTCACGTGCACACCAGTCGAGCTGATTCAAGAATCCATCCATGGCTTCCAAATGCCATATCGCCAACATCGCCAACAATTTCAAACATGATGTATGGTTTCCCGACGTCGTCCATTCACCCATACGTAAACTGTTCTACGTCTTATTCAACAAACCCACCCCCTCCCCCTGGACTAGGCCCTCCCGCTGTGACTCTGGCTTCACTGGCAAATCATGTTTCAAATGGTTATCCTTTTAATCATTCCATGCCTGCTTCAAGTATTTACGTCAACGGCGCAAGCACAGGTCCTGCGCAAAGTCATTTGAGCAAATCAGGATGTCAGTTGAGCGAAAGGAATGGTAGCCCACTTGGGCACAGAACACCAAGTCCCATTGGCAGTGGAAGCCCTATTGACAGACAAAGCATGAATGGAAGTCCAATGAGACGAAGTTCATCTGGTAGCTTAAGTCCCATGAGTCCTCTATGCACAAGCCCTTTGACGGTAGAGGATGAGGCAAATCTTCACGGCATTTCCAGTGGAAATGATCTTAATGGCTCTATCCCTTACCACGACATGCAATCGCATCAAAGCAATGGTGGAAGCCAGAACCCAGTTGGTTCTTCTGCAAACCATGTTTCTAAGCGACAGACGGTTCAAATCTTGTCTGGAGCAAAGAATGTTAATTTACAGACAAGTACCTCAAGTTTGGCCTCGGACACAGATCAATTGGATGACAGTTTAAACTCATCGTTAGCGCTTTTAAAAAGAATTCTTCCAAACGCTCCAACACAGCCGGCTGACAAATACGATCAAATGAAGTCGATGGCGACTGAAGCAATGCAAAAGAAAGTTGTTGTCAACGAAGTGAGGAGACCAACAAACACGTGGAGTGGGCTTGGGTTTTCCAAATCGATGCCGGAATCAGCCATCAAAGAACTGATGGATTTCAATACCCACAAGAAAGGGAATTTGATGCCTTACAATGGTTCCATCAACGGTAGTTTCGAGCACACCAATTCTTCATCACTGTTTACTTCTGGTCCACGGGATACCCGACGGGAAAGTGATTTTGAGTCCTCGCTCAGGACGGAACGTTTTGAGGAAGAGGATTCGTCTCCTGAAAGTTCTTGTGCAGGAACAGTTATTGGTTCCAGAAGAGACAGCTTTTCGTCCGTGGCACTTTGTCAAGATCTCCGGGAGCTTTTTGAAAAAGCTGGCTTTGCAAAGTACTTTAGCATTTTCCAGGAACAAGAGGTTGACTTTCCGACATTTATGACGTTAACGGACGATGATCTCCGAGAATTGGGTATTGGTGCGCTCGGCGCGCGAAAGAAAATGCTTCTCGCAATTCAAGCTGAAAATTCCAGAACAGGAAGAGCAGAGTCGCGAAAAAACAGCTTTCCGTCTTTTGCCTATTGCTCAGATCTCCGAGAACTGTTAGAAAAAATTGACCTCGCAAAGTACTTCAGCGTCTTCCAAGAACAAGAGGTTGATTTGCCGACTTTTATGACTCTGACGGACAAAGACCTCAAGGAACTTGGCATCTCTACGTTTGGTATAAGAAAAAAAATCTTGGTGACAATCCAAGATTTAAAGATGAATCCAAATGAAGATAGTGAGGATTCAGGGCGAGGCCCTGCTGGCCACACCAGCCCACCGCGAGTGTTCTTCTCCGACGCCAACATTTACACTCCACCGTTTCATCGTCGACATCCTTTCGGAATAGCAAGCAAAAGTGGAAGGTGGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5U4T7	Protein bicaudal C homolog 1-B OS=Xenopus laevis OX=8355 GN=bicc1-b PE=2 SV=1
Q99MQ1	Protein bicaudal C homolog 1 OS=Mus musculus OX=10090 GN=Bicc1 PE=1 SV=1
Q9H694	Protein bicaudal C homolog 1 OS=Homo sapiens OX=9606 GN=BICC1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003620 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00013 all species →	KH_1	KH domain	Domain	Interproscan
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004087 all species →	Domain	K Homology domain	Interproscan
IPR047554 all species →	Domain	BICC1, second type I KH	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR036612 all species →	Homologous_superfamily	K Homology domain, type 1 superfamily	Interproscan
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR004088 all species →	Domain	K Homology domain, type 1	Interproscan
IPR047549 all species →	Domain	BICC1, first type I KH domain	Interproscan
IPR047553 all species →	Domain	BICC1, third type I KH domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10627 all species →	SCP160	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18756	BICC1, BICC; protein bicaudal C	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074616635.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

78TPM > 0

2Conditions

52.9Max TPM

21.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	43	21.87	44.13
all_coral_tissue · baseline	38	35	21.37	52.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.13
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.91
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.44
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.24
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.75
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.39
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.62
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.80
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.79
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.55
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.38
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.14
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.02
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.75
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.69
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.08
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.85
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.75
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.22
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.08
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.83
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.59
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.03
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.98
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.55
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.54
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.14
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.00
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.82
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.30
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.21
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.11
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.34
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.11
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.46
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.38
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.19
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.06
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.02
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.33
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.27
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.03
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.31
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.91
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.39
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.32
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.71
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.78
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.12
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.94
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.32
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.88
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.27
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.25
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.91
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.79
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.79
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.59
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.85
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.84
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.33
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.55
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.19
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.38
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.37
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.95
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.15
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.69
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.17
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.58
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.05
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.73
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.70
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.56
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.63
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.07
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.82
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.64
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.