Gene detail

Detailed information of XP_074617149.1 in Acropora palmata

Genomic Location: NC_133884.1:22270772...22277056
NR annotation: XP_015764984.1, PREDICTED: double-stranded RNA-specific editase Adar-like isoform X3 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074617149.1

ATGGCAGTGAGAGGTGACAATCAGACTTCTTCATCAATGAATGATGCACTCAAGCACAAAATTCTTTACACTCTGAAGAAGACACCACATGCATGTACATTGAGCGATTTGCAACACAGTGTTGCAATTGGCACTAAGCAGGAAAGCCTGATCCAGTGCATTAACCAACTAGAGCATTCTGGAAAGATTAAGCGTATCATGAGCATGCCGCCCATGTGGGGTATTAATGAGGATTCAAGGAAAAGTGACAAAGAAGGAGAGGATTGTGGGATGACAGAACTGCAAACAGTAGGATCAAACAATCAATCTGATATTAGCAAGAGTGATACTCTGGAAGGTGGAAGTGATGAAAATGTCAGATACAAAAAAACAGCTCCGTGCTCTGGAAAAAATTCTGAGGCCAGCAAGGGAAATAAGAAGGAAGTTGATAAAGAAGAATGTCAGGAGCCTCAACCACAAACAGTCATCCCCGAACATGAATCGAACTGCAGTGAAACTGACGGCAGAGAAAATGCCGAAGTTGAGGAAGAACAAGCAGAAGGCCCAAATGAGGATAATCATGAAAATGTCTTCAGAGAATACCCCAGCAAAGGAGACAGAGCTTTGGTGGTAAAAGCAGATTCTTGTGATGGGTTTTGTGGAATGGAAAATAATGAACATGGTCCTTCGTCCTATGGTGTCAGGTCAGATCCACTACCACGTGTAACACCTGCTTCTCACCGCGGTCCGTCTGCTGCTGTGTCCTTTCCTGGCAATCAACCATCACGTGGACCCCCTCCACCACCCACAGCTCAATTGTATAGTACTTTGATGTTGCAGAGCAGAATGCAGCCGGCTCCTGTTAGAATGTCCCAGGGCACAAGACAGCCGAGGACTCTTTTGCAGCCACCATTTGCGCAAGAGCTTTCCAGGCAAGCAGCACCTCCACCACTGATGTCTTCATATGTTCCACGAGCCTCACAACCTTCGTTTCCAAAATCCGAATCACGTGGAAACTTTCAGCAGCCCATATTAACAAATCCAGGTCCTCTCCAACTCAAGGCAGCACGTTTTCCTAAGCAAACAGATCCTCTTCCTCGGCAAACTTGTCGGGATGACCAAGAAACCATATCGTTTCAAAGAAATCAACCTGAAGCTCTTGGCAACCAGCCAAACCCTCCAAGGAGTCAATCCCAAGCTTCTCGTGGAATTCTGCAACAGCACGCTCCCACTTCTGTTGGTCATCCCCAGGTAATTCACTCTTCCAGTCAAGGTTCAGGTCGGATCCCCCCACCTCCCTCAGCAAACCTTTACGAGAATTTGGTCAAACGCGGTCCTCAGGCGGTGCCGACGTCGAGCCAGAATCCTTTGATCGCCTCATCGCGGCAACCGTCAAGACTAAGTGATCTGGAATCAAAGGTAATTGATTTTATGAAGGGACACAAAAAAGCGCTTGAAACTCTGCAACTGGCCAGGCAGTTTGGTTTTCAGACCAAGAAACAGATTAATCCTACGTTATACAAACTGCAGTCTATAGGATTAATTTACAAGGTACACGACCAGCCTCCCACGTGGAAGATACGCCAAGAAGTGAGTTCCCTGACGTTCTCTGGATCCGGAGCAGGAAATATCAGTGAAGTTCCCATCGATAGGAAACGAACGCACTCCGATACAGATGACACTGCGACCGTTAAAAGACACAACCCATCTAGATCCCAAGATATTCTGTCTGGTATGTCTGTTCCGAGCCGTTCTGTGCATGAAATGTCTACCCCACAAGAGGCATCAATAAGTAGACCGTCCAGCGGTCCGTGGAATCTCGAGTCAAGTCCACAAGGATACCAAGGACGTCAAAATGACCCTCCAGATGTCCTTTCCAGCGTTGCGTATGCGGCCATGAACAAAAATCCCGTTAGTGCTCTGAATGAGTACGTGCAGAAGAACAGAATGAATCTCTCTTTCGAAACTCTTGGAACACGTCCAACGTTCGCGGTTGCGGCTAAAATAAACGGTAAACTGTACCCTGCAGCAAACGCACGGAACTTGAAAGAGGCCAAACGTGAAGCCGCAGATTTTGCTTTAAGAAGCCTGCTTGGTCAAGGTGCAAATGGTGGAAGGAATGCTAACGCCGCGTCGTTACATATTTCTAACCCGTCTGCTAGCACGCTCAGCAAGGCTACAACACATTTTGATCGCATTGCTGCTCTCTCACACAACGCATTTCTGCAAATTGCAGCTACTATTGCCGACAAGTTTGCCGGAAGAAAGGTCGTGGCATGCATCATCATGAAGCAAGGGGATGAGGACAATGGTAAGGTTGTTGCCGTGGGAACTGGAAACCGCTGCGTGACAGGAGAGAGGTTGAGCATGGAAGGAAACACAGTCAATGATTCTCATGCAGAAATCGTCGCCAGAAGATCCTTGATGCGGTTCTTCTATCGGCAATTGAACAGTTACCACGATGGTGGCGAATCGATTTTCGCATCGAAACAGGGCTCCTGTAAGCTAGTCTTGCGCGACGGTGTGTCATTTCATCTCTATATTAGTACAGCCCCGTGTGGTGATGGCGCCTTGTTCACGCCCCGAGAGGAATCAAGAGCAGTTCTCTCGGAACACTCAAAAGAACATAATCCTACTTTTACATCAAAACAGCAAGGTATCCTGCGTACAAAGATCGAAGATGGTGAAGGTACAATCCCCATCGACCCCTCTGATGGAATTCAAACATGGGATGGGCTTATGCGTGGTAAACGATTGCGCACTATGTCATGCAGTGACAAGATATGTCGCTGGAATGTTCTTGGACTTCAAGGCGCCCTCCTGAGCCATTTCCTCGAGCCGGTGTACTTGTCATCTCTCACTCTGGGATACCTGTACGATCACGGTCATCTCTCGCGTGCTGTCTGCTGTCGTCTCCAGCGCAATTGTGACCTTAACAACCAGCTACCCGCGCCTTATCACGTGAACCACCCGTGGCTAGGATGTGTGACAGCTTATGATCCACCACGTGAAACAGAAAAGACAAACAATCTGAGCGTCAATTGGTCCATTACTGACACGAGCGCAGAAGTGACAGATGGACGCACGGGTGCTTGCATGACACGGACGCAAAACGGTCCAACGCCTTCCCGCGTCTGTAAAGCTATCCTCTTTAATTCTTTTAAGGAAATTGCTGCCAAAGTTGGCCGTCAAGAACTCGTGAATGCCGAATCCTACAGCGACGCGAAAAAGATGGCGACTGCTTTCCAAGAGGCCAAGTGGAAACTGTTCGAGCATTTTAGATCTTTGAAGTACGGTTCTTGGGTCAGTAAACCGATTGAACAAGAAATGTTCTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q99MU3	Double-stranded RNA-specific adenosine deaminase OS=Mus musculus OX=10090 GN=Adar PE=1 SV=2
P55266	Double-stranded RNA-specific adenosine deaminase OS=Rattus norvegicus OX=10116 GN=Adar PE=1 SV=1
P55265	Double-stranded RNA-specific adenosine deaminase OS=Homo sapiens OX=9606 GN=ADAR PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001415 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02295 all species →	z-alpha	Adenosine deaminase z-alpha domain	Domain	Interproscan
PF00035 all species →	dsrm	Double-stranded RNA binding motif	Domain	Interproscan
PF02137 all species →	A_deamin	Adenosine-deaminase (editase) domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR042371 all species →	Domain	Z-binding domain	Interproscan
IPR002466 all species →	Domain	Adenosine deaminase/editase	Interproscan
IPR014720 all species →	Domain	Double-stranded RNA-binding domain	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10910 all species →	EUKARYOTE SPECIFIC DSRNA BINDING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003725 all species →	Molecular Function	double-stranded RNA binding	Interproscan
GO:0003726 all species →	Molecular Function	double-stranded RNA adenosine deaminase activity	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006382 all species →	Biological Process	adenosine to inosine editing	Interproscan
GO:0006396 all species →	Biological Process	RNA processing	Interproscan
GO:0008251 all species →	Molecular Function	tRNA-specific adenosine deaminase activity	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0004000 all species →	Molecular Function	adenosine deaminase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12968	ADAR, ADAR1; double-stranded RNA-specific adenosine deaminase	EC:3.5.4.37	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074617149.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

68TPM > 0

2Conditions

24.2Max TPM

11.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	35	7.98	20.59
all_coral_tissue · baseline	38	33	15.06	24.18

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.59
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.31
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.80
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.70
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.53
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.28
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.46
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.08
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.59
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.40
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.14
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.80
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.68
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.42
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.21
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.06
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.05
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.87
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.62
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.95
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.67
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.10
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.44
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.38
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.98
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.87
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.78
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.74
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.27
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.00
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.77
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.26
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.62
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.59
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.94
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.18
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.62
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.11
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.69
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.56
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.23
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.94
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.44
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.42
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.31
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.58
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.22
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.21
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.08
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.72
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.56
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.36
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.22
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.87
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.59
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.49
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.40
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.40
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.89
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.61
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.54
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.69
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.74
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.37
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.64
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.63
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.82
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.24
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.