Gene detail

Detailed information of XP_074617567.1 in Acropora palmata

Genomic Location: NC_133884.1:24168963...24194640
NR annotation: XP_044174935.1, oxysterol-binding protein-related protein 11-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074617567.1

ATGGCGGTCGCTGAGGATATTTTAAACGATCCGTATTTTGCCGATCTAGACATAGACTTGAGCCAATTTTCAGAGCAAGAGAAGAGCGTCATTATTGGTGTTATGCAGAAAGCTAAAAATCTCGATCAACAGGATGATGATAAATATAGGAAACCCACAGAGGGACAACTTAGCAAATGGACCAACCTGATGAAGGGCTGGCAGTTTAGATGGTTTACGCTGGATCCTGAGTCAGGATTGCTGGAGTATTATGTTGACAAAGAGAAGAAGAAGTTAGGTCCCAGAGGATCTGTTTATCTTGGAGGAAGTATTATATCACCCAGTGATGAAGACTCTTTTACTTTCACTGTCAGTGCTGCCAATGGGGATATTTTTAAGCTCCGAGCCAGTGATGCGAAAGAAAGGCAAGACTGGATAAACAAGCTTCGCAGTGTGGCGGAGTTTCACGCATCGAGCATTGGACAGGCTGCCCCTCCGCTCTATAAGACATCTAGTTTTTCAGTTCCTACTCCTCAGCCCTCTGCCATGGTGAAACAGCCAGCTTCAGTAGCCTTGGCAACTGGTCCATCCGCCACAGTGACAGCGGAAAACATGAAATGCGACTCGCCTAGACCCCAACGAAAAATCGTACAAGTTTCTGAGAATGTCCTGTCAGGACTGACGCAAGTCAGGGAGGACCTGTACAGAATAGAGGATAATCAAATGACATTTATCGATCAACTAGAGTTGGATCCAACTGGAGAAGAGTCACTTCTACCCCTCGCATCTGATGTTCTTATCCTAAAGGCAACTGCACAGGCGGCCCTCGGCTCGCTTCACCACTGTTTTTCAATTCTACAAGGACAGGCCGCTGATCTTCAAACCGAAATGCCAGGTCAAGATTGGCGGCCCCAAAACGGAAATACAGAAGTTGAGAGTGAGACGGCAAGTTACGCAATGAATCGCAGACGACTTTTAAGCTTCAAGTCACAAAATGACAGACCGGCTGGGGAAAGTCGCCATCTTGCATCCGGCAAGAGTGTGTCAACGCCGAAATCGCAAAGACCTACAGAACCCACCGAAAACTCTACAGTGCCTTTCTGCGAGAAAGCACGAGTGGAAATGCAGTATAATATTGGGCCAACAGATGAAGAACCAGACGAAGAAGCGTACTGCGCCGGAGAGGAACCTGAGAACCAGTCAGTCGAGGAACACAAGAGTGTCATCTTACACCTACTTTCGCAACTTAAGCTGGGAATGGATCTCACTAAGGTTGTTTTACCCACTTTTATTCTTGAGCCACGTTCGTTGTTAGAAATGTACGCCGACTTCCTCGCTCACCCGGATCTATTTGCCAGAATTCCCGATGGTCTTACTGCAGAGGATCGAATGTTAGCTGTTTTAGAATTTTACCTAACCTCATTTCATGCAGGAAGGAAGGGAGCCTTAGCTAAGAAACCTTACAATCCCATATTGGGAGAAACGTTTCGTTGTTCGTGGCAAGTCGCAAGCTCGTTAAATCCACATAACAGTACAACAGACAATAGCAGTGAGAGTTCCACGACCGCTACGGACTACAGAAAGGTCACTTTCGTCGCCGAACAAGTTTCCCATCATCCTCCAATTTCTGGATTTTATGCCGAGTGTCCTAGCAAAAAGATTTGTTTTAATGTCCACATTTGGACGAAGTCGAAGTTTTACGGGATGTCAATAGGAGTTGTGAACCATGGGGAAGGTGTCATCTCGCTGTTAGAGCACAACGAAGATTATGTTATAACTTTTCCTAGCACGTATTGTAGGTCAATTTTAACTTTTCCTTGGGTGGAGTTGGGTGGGAAAGTTAACATCACCTGCTCCAAGACCGGATACACCGCATCTGTGACGTTTCACACAAAACCCTTTTATGGAGGCAAGCTTCACCGGGTCACGGGCGAGGTCAAAAACATTTCCACGGGACGGGTGATCTGTAAAATAAATGGCGAATGGAATTCAACGATGGAATTCAGCTTTACGAGTAACCAGGAAGAACCCAAAATTCTAGACACAAGAAAACTTCCTGTTTTTTGCAAGAGGGTTTGCCCACAGTCACAGCAAGAGGAGTGCGAGTCGCGAAGAGTTTGGCAGAAAGTCACTCAAGCGCTCAAGGCTGATAACATCGAGGCTGCTACATCAGCGAAACACGAGATTGAAGAAAAGCAAAGAAGAGAAGCTAGAGAAAGAAAAGAGGCTGCTTTTCCATCGTCATGGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9BXB4	Oxysterol-binding protein-related protein 11 OS=Homo sapiens OX=9606 GN=OSBPL11 PE=1 SV=2
Q8CI95	Oxysterol-binding protein-related protein 11 OS=Mus musculus OX=10090 GN=Osbpl11 PE=1 SV=2
Q9BXB5	Oxysterol-binding protein-related protein 10 OS=Homo sapiens OX=9606 GN=OSBPL10 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001309 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00169 all species →	PH	PH domain	Domain	Interproscan
PF01237 all species →	Oxysterol_BP	Oxysterol-binding protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR037239 all species →	Homologous_superfamily	Oxysterol-binding protein superfamily	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR000648 all species →	Family	Oxysterol-binding protein	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR018494 all species →	Conserved_site	Oxysterol-binding protein, conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10972 all species →	OXYSTEROL-BINDING PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0008289 all species →	Molecular Function	lipid binding	Interproscan
GO:0015248 all species →	Molecular Function	obsolete sterol transporter activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0032934 all species →	Molecular Function	sterol binding	Interproscan
GO:0043231 all species →	Cellular Component	intracellular membrane-bounded organelle	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20465	OSBPL9_10_11, ORP9_10_11; oxysterol-binding protein-related protein 9/10/11	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074617567.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

69TPM > 0

2Conditions

35.6Max TPM

18.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	36	15.41	29.41
all_coral_tissue · baseline	38	33	22.05	35.62

Per sample · hover a bar for the full sample record

Show the sample table (84 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.41
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.92
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.92
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.88
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.65
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.11
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.73
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.40
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.38
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.21
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.87
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.58
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.49
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.82
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.33
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.99
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.97
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.54
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.35
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.42
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.14
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.91
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.49
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.22
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.60
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.39
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.33
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.29
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.23
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.14
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.01
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.31
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.98
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.31
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.64
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.81
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.62
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.47
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.16
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.69
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.93
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.71
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.67
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.28
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.71
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.12
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.12
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.29
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.16
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.85
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.13
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.70
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.51
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.39
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.14
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.09
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.79
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.47
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.31
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.71
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.12
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.66
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.30
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.05
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.63
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.72
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.55
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.92
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.08
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora palmata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	25	XP_074611491.1	0.876279809201128
Negatively correlated	3	XP_074627099.1	-0.572918466312961

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora palmata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

DNA methylation (bisulphite samples)

Sample	Methylation profile
Polyp_Underside_Control_2	open
Polyp_Underside_Control_3	open
Polyp_Underside_Treatment_1	open
Polyp_Upperside_Control_1	open
Polyp_Upperside_Treatment_3	open
Polyp_Upperside_Treatment_4	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →