Gene detail

Detailed information of XP_074617751.1 in Acropora palmata

Genomic Location: NC_133884.1:6053077...6057171
NR annotation: XP_015779744.1, PREDICTED: chondroitin sulfate synthase 1-like [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074617751.1

ATGAGATGCGATAGAAGCTGTTCACAGGTAAACCTGATCATTGAACTCTTTGCGAAAGAAAACAAAGAAAAAAAACTCAAGATGGTGACAATGCACCAGTGTATATTTCTGTTTCTTGGATTTATCATTGGCTTCCACATCACTCTGTTTGTTAGACAGAATCAATGCCGTTTGATTTATGCAACTCAGTTTCGACCGAAGACTTTGAGTGGAGAGCTTGGAAACCGTAAGTTTTTATTCGTTGGTGTTATGACCGCCGAACAGTTAGTGGAGACAAGAGCCAAAGCAGTTTACGATACGTGGGGCAAGACTGTTCCAGGTACACTAACATTCTTTTCAAGCGGCGAAACTGGAAAGACGCTTGGTTTACCGGTTGTAACTTTACCCAGTGTAGATGATACGTATCCACCGCTAAAGAAGTCTTTGATGATGATTAAATACATGCACGATTTCCACATCGATGAGTACGAATGGTTTATGAGAGCCGATGACGATGTGTACGTCCGAAACGACAGATTAGTTGAATTTTTACATTCTTTAAACAGTTCTGATGATATTCATCTGGGACACGCGGGTATAGGCGCAAAGGAAGAACTTGGAATGCTAAGCATGAATCCTGGCGATAACTATTGCATCGGGGGACCGGGTGTGATATTAAGCCGGAGTGTTTTAAAGAAAGTTGCGCCTCATTTGGAACATTGTTTAGAAACAGCGCCAACAACTCACGAAGATATCGAAGTTGGACGATGCATTCAGCGTTATGCTGGAGTCAAGTGCACTTGGGCTTATGAGATGAGAACCCTTTTCTTTCATCACTACACTGAGAAGGGACAAATATTTCACGGGGACCTCAACACCAACACCATTCGCGATGCCATCACACTGCACCCGATTAAAGAACCCGCCTACATGCATCGCTTGCACCTGCATTTCAAGAACGTGCGAATTCAACAATTGCAACACCAAGCTGTTAAACTGCAACGTGTCCTGAGAAATATGGATCACTTGATACAAGCTGAACAAACTCCACAGCCGGTTCAGTCAAAGGTCGACCTTTTGGATCCAAGAGAGTTTCACGATCAATTACCGAGAAATGCAACTGAACAATGGAATATGTTTACTTCAAACTCATTTTACTTTGATGAGAAGTTGCGTTCTCCTGGGACAGGCATTCGCGGGGCATTAAAAATTGAATTCACAAATGCATTAGACAGAAACTCGGACTTTTTAAAAGAGGAGGCCAGGAGAATTCCAAACTCAGGAAATAGGAAAATTCAGAAGATCAATTACGGTTACAGACGGTTCCATCCTTTGTACGGAGTTGAACACATCATGCAATTAACAGTCAAGACGGAGAAAAAGGTCCGACTTGAAAACTCTGGAAAAACCCAACAAATTTCAACTTCACGAAATAGATGGTTTCACACACAGCTACCATTTGGAAACCTGTTACACAAAGTTGAGCCGCTCGCCGTTGCTTCATCGTATGTACACTTTCTTGTCCCGTTAGAAGGACGTTTGGAAACGTTTCGTCGATTTATGAACAACTTCGAAGAAGTCTGCCTCAAACCACGGTTGTTGGTAAAACTTGTTGTAGCATATTCATCTCAGGTGTCTTCTCCTGATCAACACAAAGCCATATTGAAAGAATATCAAAATAAATATCCTTTGGCGGGTCTCATCTGGATTGACGTTGAGGGTAACTTTTCCCGCGGGATCGCTCTTTCTCTCGCGGCTGATCAATTTGACGAAACAGCGTTGTTGTTCCTATGTGATGTTGACTTGGTTTTCAGCAAAGCATTTGTCGATCGTTGTCGAATGAACACAGTTCTTGGCAAAACAGTATATTATCCAATCATGTTTAGTCAGTTTGAGCCTGAATTATCTCACACTAACAACACCATCCGTGGTTCGTATTACACCATAAACAAAGATGCGGGCATCTGGCGAACATATTCATATGGACCCGCCTGCCTACATCATCGAGATCTACACGCTGTGGGAGGGTTTGACACAAGCATTAAAGGCTGGGGATGGGAAGATGTGGATTTATATGAAAAATTTGTCAACCATACTGAGATTGACGTATTTCGAGCAGCAGATCCCGATCTTATACATATTTATCATCCTGTAAAATGCAATCACAATCTTCCAGATCGACAAATGACGCTTTGTAAAGGATCCAAAGCTTCGGGGCTAGCCAATCAAAAGTCACTAGTGAGAGCTATGATAGAAATATCCAAGAATACAAAACGTTCTCAACTAAAGTTATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6ZQ11	Chondroitin sulfate synthase 1 OS=Mus musculus OX=10090 GN=Chsy1 PE=2 SV=2
Q86X52	Chondroitin sulfate synthase 1 OS=Homo sapiens OX=9606 GN=CHSY1 PE=1 SV=3
Q70JA7	Chondroitin sulfate synthase 3 OS=Homo sapiens OX=9606 GN=CHSY3 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000765 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05679 all species →	CHGN	Chondroitin N-acetylgalactosaminyltransferase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029044 all species →	Homologous_superfamily	Nucleotide-diphospho-sugar transferases	Interproscan
IPR051227 all species →	Family	Chondroitin sulfate glycosyltransferase	Interproscan
IPR008428 all species →	Family	Chondroitin N-acetylgalactosaminyltransferase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12369 all species →	CHONDROITIN SYNTHASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008376 all species →	Molecular Function	acetylgalactosaminyltransferase activity	Interproscan
GO:0030206 all species →	Biological Process	chondroitin sulfate biosynthetic process	Interproscan
GO:0047238 all species →	Molecular Function	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity	Interproscan
GO:0032580 all species →	Cellular Component	Golgi cisterna membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13499	CHSY; chondroitin sulfate synthase	EC:2.4.1.175 EC:2.4.1.226	Glycosyltransferases	ko01003	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074617751.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

51TPM > 0

2Conditions

25.2Max TPM

5.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	26	5.50	25.23
all_coral_tissue · baseline	38	25	5.71	16.82

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.23
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.87
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.82
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.02
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.14
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.65
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.56
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.51
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.57
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.17
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.75
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.78
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.40
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.01
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.83
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.41
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.16
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.46
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.12
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.97
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.90
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.76
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.44
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.54
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.42
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.36
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.82
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.31
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.62
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.12
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.75
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.40
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.95
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.95
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.81
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.78
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.91
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.77
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.75
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.62
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.26
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.56
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.09
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.45
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.14
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.19
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.61
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.14
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.80
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.60
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.54
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.