Gene detail

Detailed information of XP_074618093.1 in Acropora palmata

Genomic Location: NC_133884.1:545468...568270
NR annotation: XP_029213675.2, L-fucose kinase-like isoform X2 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074618093.1

ATGAGGCGAAAAGATGATGGAAGAAATTCGTGGGACGCCATTGTACTTACTTGTCAAAGGAAAACCAGTGCTCGAGCTATCCAGAAAGAACTTGAAGTACACCAGGGCAAGGGGTTTATTGGGAAAGATGTTGTGCTCATAACTTTGGAAGATCCGAAAGGTGGCGTTGGGAGCGGTGGTGCAACACTTAATGCCTTGCTTGTGGTTACAGAACATTTAAGTGCTAAAGCTGGTTTTCGGGTTGTCACAGAAAGTGTTTTGGAGAATGCAAGAATACTCATAATGCATTTGGGGTTTAGTTTCCCATTCAGCTCTTGTGGGAGATTTTTCAATCAACTTCCAGCAAAACACTCGGAAGAATCTAAAGAGAACCTCTGTGATTCCACTGTCCTTAATTTTGATTTAGTACTGTACATTCTTTCAAACACGTTGTCGCTGAATGCCCCCCCAGGTGTATGGATTTGCAGTTCAGATATGATACCTTCGATTCCACTCAACCAAAGGATAAACTGGGAGCAATGTTCAGGAGGGACAATTTTGTTTCTCTCACAAGGAGATGTGCAGTATGCTAAGGACCATGGTGTTGCTAAACTTGGTGAAGATGGCAACATCAAAGACATCATTTTCCGAGAAAGTGAGGATAAAATAAAAAGCTTTGCTCTGGAGAATGGGAAGGTTCCTGTGGTCAGTGGTTGGGTGTACATGAGTAGCAGAGTGGCTTTTAAAGTGTTGAGTCTCCATGTCTATCATCCTTTAGATGCTTGTAGTTATTATGGACTGGATAATGGTGCAGAGGCCATCCAGTTATCCATGATCTTCGACATTCTCCTTTGTATGGCTGAGGATGTTATTGAATCAGCTTTTGTTGATGGAGACAGGAGTGGTACTTATTCAAAGCGACGCCAGGTGGAGACGAGTCGAACCGCACAACAGGAAGCGATGTTAATGAGGAGTGCAAGGGCACAGCTGTGGAACAATCTACGCGGACTGCAGTTGAAAGGAGTTTTAATCGAAAATGGATCATTTTATTACATGAAGGCATCCGCAGAGTGTTACAGAAGACAAATGTTAGAAAGCCCTCAAATTCTACAGTTTAGTGGTTTACCCTATAATTCCAGCAATGTTATGCATGTGACCTTTTGTAAGAATGGAACATTGAGTGATGGTAATCACGTGCCGAAGTCGTGTATCGTCATCAATTCCAATTTGGATGATGTCATTAAGATTGGAGAGAATTCTGTCATCACCAACTGTGAATTAAAGGGTGATATAACTATTGGTCAAGGCTCTGTTTTCGTCGGCGTTTCCTCAGATATCATGAAGGATGTTCCAGCCGGTTTTGCTTTTCCAGATGAATTGTGTGTCATGCAGTTCAAAGTTTGTATTCCAAAACTCAGTGATAAAGCGCAGCAAGTGTTGGTAGTGATGGGCGTCCATGATGATTTTCAGTTGCCGTTTTCATCGCCCGAGAGCACATATTGCAACAAGCCCTGGGAAACATTTTTCAAGGAGGCTGGAAATAGCCCCGAAGAGATCTGGTTTGGTGTGCGTGAAGATGAGCGATGCCTGTGGAACGCAAGGTTGTTCCCTGTTGTTCATTTCTTCTCGGCCGCAAACGAGAACACTGGCAAAGACGATGTGTTGTGGTTAGCTATGGCCACTTGCGGTGCTTTCGGATCGTCCAACAAAAGGATAGACACCAACAGAAATTTCAGATGGCGGTCCTCCTTGAGGTTATCTTTAAAAGAAATTATGGCATTGGTCGATTTGCCAGCAGAGTTCGAATGGACGAAGAAATTGTGGTTTCAAATTGGCAAAGCTCAAGTCGAGGACACGTTAAGGAACTGTAGAAATGAATGCCTCCTCCCTTTCTTTAGGAGCTGTATCCATGAAGGATTTGAAAAAGATCTCTTGGAAACCTTAGATCATGTTGCATCAAGCACCAGTTCTCCAGGCGTGGCTGCGCGAACTCTTGCCTGTGTTGCTGACGTTTTGGGTGCGATGGCAGGAGAGAGAGCTGGACTGAGAAGTGGCCCGGCGCGCAATGAATCCTGGATGGAGGCATTAGAGTTTCTAGAGAAAGAGGATACCGAAGCTGGAGTGAAAAGACTTGCAAAGGAGAGGAATCTATGGTTTGATAGACCTGATCTTCTGATTCGAGCGGCTCGCCATTATGAAGGAGCGGAGCAGATTTTAAGAAGGCAGGCAGTTTTCACTGCTAAAAAGTTTTTTGACAGTGAAGAATGCGAACCCCTTCCCATGGGTGACTGGGTCTACGCTGAAGCTCCTGCTCGTGTGGATTTGTCAGGATGTTGGACGGACACACCTCCTATCACATACGAACATGGTGGGGCAGTGCTAACAGCAGCCATAAACCTCAATGGCAAGAAAGTAATGGGAGCCAAAGTGAGAAAAATACCCGAGTTCGAGATTGTTCTTGTGATCCATGCCGGAGAACACAGTGTTAAGGTTGTCTGTAGTGAGTTGAGTGATTTGGAAAACTATACTCAACCACACGCCCCAGGTGCTCTTCTTAAAGCGTGCTTTTGCCTCTTGGACATTGTAACACTTCCATCAAACGAATCTTTGCCTGAGCAATTAAGAAAAAGGTTCAACGCGGGCTTCGAACTCCACACCTGGTCAATTGCGCCTCAAGGAAGTGGTCTTGGAACCAGTAGCATTTTGGCAGGAGTTATCCTTGCAGCGTTGCTAAGGGCAACAGGACGAAAAGCAAGTCTGGATTCTCTCGTGCACGCGGTTTTGTTGATCGAACAGATGTTGACGACCGGTGGCGGTTGGCAAGACAATGCGGGTGGACTGTTTCCTGGTTTTAAGATGACTCGGTCCAAGGACTCCTTGCCTTTAAAGGTTGAAGTTGAACAACTGAACTTGTCTCAAGAAACTGTGGACAAGTTTACCGAGAGACTGATATGCCTCTACTCAGGGAAACCACGCCTTGCTAAGAACCTTTTGCAGGACGTTGTCAGGAACTGGTACGCGAGGTTTCCGCAAATAACTCGAAACGCTGATGAGCTGATAAGCAATGCAGAAGAAGCGGCCACAGCTCTGAAAGAAGGGGACATCGAGAAGCTCGGCGCATGCGTAAGCTGCTATCGCAAACAGAAATGCATTATGGCACCTGGAACTGAACCAGATTCAATTCACGAAGTGATGGAGGCAATAGATCCATTGGTTTTGGGACAAACTTTGACCGGAGCGGGTGGGGGAGGGTTTTTGGTGCTTATCACGAAAGAACCAAACATGGCGGACAAAGTTAAAGCTGTTATTCAGGAAAAGAAGGCTTCTGATGAGTTTACTTTTTATGATGTGAGCGTAGACTGGGAAGGATTGACTGTCAGAGTGGAGTCATCTCAGCAGGGAACCTCATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8N0W3	L-fucose kinase OS=Homo sapiens OX=9606 GN=FCSK PE=1 SV=2
Q7TMC8	L-fucose kinase OS=Mus musculus OX=10090 GN=Fcsk PE=1 SV=1
Q9LNJ9	Bifunctional fucokinase/GDP-fucose pyrophosphorylase OS=Arabidopsis thaliana OX=3702 GN=FKGP PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001981 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08544 all species →	GHMP_kinases_C	GHMP kinases C terminal	Family	Interproscan
PF00288 all species →	GHMP_kinases_N	GHMP kinases N terminal domain	Family	Interproscan
PF07959 all species →	Fucokinase	L-fucokinase	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013750 all species →	Domain	GHMP kinase, C-terminal domain	Interproscan
IPR006204 all species →	Domain	GHMP kinase N-terminal domain	Interproscan
IPR052203 all species →	Family	GHMP Kinase-Related Enzymes	Interproscan
IPR012887 all species →	Domain	L-fucokinase	Interproscan
IPR036554 all species →	Homologous_superfamily	GHMP kinase, C-terminal domain superfamily	Interproscan
IPR020568 all species →	Homologous_superfamily	Ribosomal protein uS5 domain 2-type superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR32463 all species →	L-FUCOSE KINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0042352 all species →	Biological Process	GDP-L-fucose salvage	Interproscan
GO:0050201 all species →	Molecular Function	fucokinase activity	Interproscan
GO:0016772 all species →	Molecular Function	transferase activity, transferring phosphorus-containing groups	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05305	FUK; fucokinase	EC:2.7.1.52	Amino sugar and nucleotide sugar metabolism	ko00520	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074618093.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

80TPM > 0

2Conditions

97.7Max TPM

46.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	43	41.19	97.66
all_coral_tissue · baseline	38	37	52.78	73.67

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	97.66
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.96
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.65
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.01
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	58.99
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.98
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.16
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.72
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.11
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.44
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.17
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.33
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.93
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.45
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.43
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.04
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.73
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.49
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.40
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.62
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.26
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.26
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.66
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.56
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.21
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.09
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.80
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.28
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.98
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.64
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.89
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.81
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.42
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.63
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.97
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.76
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.92
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.86
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.04
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.45
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.46
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.54
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.01
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	73.67
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.37
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.45
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	67.04
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	67.01
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	65.65
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.83
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.06
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.86
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.40
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.02
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.99
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	60.28
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.91
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.84
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.18
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.93
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.71
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.63
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.51
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.89
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.34
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.07
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.04
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.53
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.58
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.17
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.17
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.93
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.53
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.11
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.30
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.70
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.45
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.83
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.96
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.63
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.