Gene detail

Detailed information of XP_074619042.1 in Acropora palmata

Genomic Location: NC_133884.1:9070170...9085553
NR annotation: XP_029191114.2, terminal nucleotidyltransferase 4B-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074619042.1

ATGCTTTCCCCATTGAGGATGGCTTCCAGAATGGGCTGGATTCAACAAGAGCAAAACGCTCCAACATTTGAAACATGGAGCGACGTGTTGGGGGACGTTAATTCACCATCGACAAAACCGGGAAATGTTTATGATGAAATGGCGAATTATATCCCTTTGAACCGTAAAAATAATTTACATGAAAATGTAGAGAGCACCACTTTCAAGAACATGATTAACGAGGGAAAAAATCGTGTCAGTAAGAAGAAAAAAATTGAAGACGGAACTCCTTGGTGGTCAAAGGATAAAAAGTATCCAGACGGCCCAGTGGGGCTTCACGAGGAAATGTGGGACTTTTACAACTTTATGAAGCCTCGCCAGGTGGAACATGCTATGCGACAAGAGGTGATATCGAGAATTCAAAAAGTCGTTAAGGGACTATGGCCAACAGCTGAAGTGGAGGTGTTTGGGAGCTATAGAACGGGGCTTTATTTACCAACCAGTGACATAGACATTGTTATTTTCGGAAAGTGGGAGAGACTACCATTATGGACGCTCGAACAAGCTCTCACTGCAAATAAAATCGCCGAGGCTTCCACCATTAAAGTCTTGGATAAAGCTTCAGTTCCTATTATAAAGCTTACCGACCAAGTAACCAAGGTGAAATTGGACATAAGCTTTAACACCCCAGATGGACTGAAAGCAGCAGACTTTGTTAAGGATCAAATGGAGATTTTTCCTTGCCTTCCACCTTTAGTACTTGTTTTGAAGCAGTTCCTTGTGCAGCGGGACCTGAATGAGGTGTTTGCTGGTGGAATAAGCTCCCACTCTCTTGTTTTAATGATAATCAGTTTTCTGCAGCAACATCCTAGAAAAGATGGAAGGACTCTTAAAAGCAACCTTGGAGTTCTTTTAATTGAATTCTTTGAACTCTATGGCAAACATTTTAATTATGAAGATGTTGGCATTCGCGTTAAGGATCGTGGATCATACTTCAACAAACAAGAGGCTTTTCATGGTATGGATGGAAACAGCCCAGATAATTATTGTGCACCTCTTTGCATTGAAGATCCCACTACAGAAGGTAACTACTTGGGAAAAAGCTCTTACAAATTCCTGGATGTGGTGCATTCCTTTGGTTATGCATATGGAATGTTGAGCAAGTCTGTTCAATATGATGTTACTACAGACAGAACAAACCCTGGAGTGACAAAGGAAAGGGATTCTGTCGGATATCTTGGACAGATAGTGAGGGTCAAAAGTGAAACACTAGAATATAGGGAATGGGTTGCCAGTGTGTGGTCTGTGCATAGTGCTCCACTCATTAAGCAATCAGCCCCTACATATGCCAGTATTGCAAATAGACATGTCCAGACTCAAGCTATTACATCTCAAGATTCCTCTGACAAAAATGCCACATGGAACAGGTCACAATCAAACTTGGAAACTCTGATGACAGTAGGCAAGGGTGAACCTTTTGTCAAACATGCCAGTGTGGACTGCCTCTCAGTCAGGGGAATGTCTTCAGTTCAAAATTCAGCAGATTCACTAGCTCAAGATATGATACCTGAAAAGATAGCTGCTTATGAAACAAGAACTTCTGTTTTTGGAGGCTCTTCAAAATCTCTGAACTTCCAACCTGCAAACAATAATGAATTGAGTTGTCCGTCTAAAGGGAGCTTGTATTCTGAAGCAATAAAGCAATCACCAACTAAAACCAAGCAAACATTCACCTCCATGCCCAAGACCTCTGCTGTTACTTCAACTTCAAAATCAAAATTGACTGCAAAATCTTCAAGATCCTCTGTTTCTGACGTAACACACATGGTTAAAACAGTGTCATCATCAGCAAGGTCTTCAACCAAAACCTGTTTTTCAGACCCCATCTCAAAGGCTAAAGTTTCTTGTGATTCAGGATTGACATTAAGCAAGACCAATTTTGTTGACTCAGTGACCAAGACAAAAGAAAGAGATCTCCAGAAAACAATGGATGAGCAAAAATCTTCACTCACTTCAAATAGCAATAATACCGTAGTTTGTGTTCCACCAAAGTTGGATCTTAATCCTCCAAGTCAGCTCAGTAAAGACAATGGTATTGGAAAACAAAGTTCAACAATCACTGTTTCGACACTGACAAAGGACAATACTAGTAATTGTCAAAATAACAACATCACTGTCTCAAAGGACCCGACAAAACGAAAACATGGAAAACCAACCAAGAGTAAAAAGGAGAAGAGCTCTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NDF8	Terminal nucleotidyltransferase 4B OS=Homo sapiens OX=9606 GN=TENT4B PE=1 SV=2
Q68ED3	Terminal nucleotidyltransferase 4B OS=Mus musculus OX=10090 GN=Tent4b PE=1 SV=2
Q6PB75	Terminal nucleotidyltransferase 4A OS=Mus musculus OX=10090 GN=Tent4a PE=2 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006717 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03828 all species →	PAP_assoc	Cid1 family poly A polymerase	Family	Interproscan
PF01909 all species →	NTP_transf_2	Nucleotidyltransferase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002058 all species →	Domain	PAP/25A-associated	Interproscan
IPR043519 all species →	Homologous_superfamily	Nucleotidyltransferase superfamily	Interproscan
IPR045862 all species →	Family	Nucleotidyltransferase Trf4-like	Interproscan
IPR002934 all species →	Domain	Polymerase, nucleotidyl transferase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23092 all species →	POLY(A) RNA POLYMERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0004652 all species →	Molecular Function	obsolete polynucleotide adenylyltransferase activity	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0031123 all species →	Biological Process	RNA 3'-end processing	Interproscan
GO:0031499 all species →	Cellular Component	TRAMP complex	Interproscan
GO:1990817 all species →	Molecular Function	poly(A) RNA polymerase activity	Interproscan
GO:0016779 all species →	Molecular Function	nucleotidyltransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03514	PAPD5_7, TRF4; non-canonical poly(A) RNA polymerase PAPD5/7	EC:2.7.7.19	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074619042.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

65TPM > 0

2Conditions

31.4Max TPM

12.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	32	9.17	26.81
all_coral_tissue · baseline	38	33	16.68	31.39

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.81
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.58
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.67
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.16
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.10
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.71
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.66
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.79
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.42
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.98
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.24
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.62
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.27
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.82
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.10
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.00
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.65
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.25
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.82
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.57
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.46
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.49
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.41
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.18
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.51
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.50
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.22
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.89
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.78
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.18
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.89
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.04
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.39
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.86
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.93
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.42
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.01
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.90
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.48
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.42
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.51
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.40
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.86
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.58
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.25
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.23
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.34
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.15
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.20
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.98
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.80
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.63
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.33
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.07
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.97
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.72
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.91
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.17
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.78
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.61
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.48
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.19
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.62
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.38
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.20
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.