Gene detail

Detailed information of XP_074619149.1 in Acropora palmata

Genomic Location: NC_133882.1:24492094...24497421
NR annotation: XP_029195611.2, LOW QUALITY PROTEIN: uncharacterized protein LOC114961175 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074619149.1

ATGGATGAAGCACGAAAAGAACGAGAGGCTCGCTTAGCTAGAAAGCTTGAACTAGAAAAACAACGGGAGAAACTTCAAATTGAGAGAGCAAGGTTGCTTTCGTTGCGAAATGAGTTGGGCCTCCAAACTTTTTCCCCTTCGTCACGATTGAGCGCGACAGTTCGGGGCACGATTAACAAAATACCCGAATTTGAGAGAGAACTTGAAACACTGCGTGAAAAGGACCAAGCACGGGCTAATATGTTAAGGAAACCCTACAGTGGTGAACTGGGGATAGGGTCATACGAACCTTGGCAACTGGAAGACGTGTACTTCGTTCGAGACTTCGTGACATTATGGGTGGACGAGGTTTTGGATTTCATCATTATACAAGATCATACGAGGACTGATAAACGGCATGAGATCGCAGATTTAACCAAACGAATGTCCGAGGAGATGGAAACCGATAGGAGAAATGAGGAACTTTTTCAGCTGAGTTTCGACATTGAACGAGGTATTCTGGCAGATGTCGTTCGCGAGGCTGCGAGAGAGACGGCGGTAAACATGTTGGAGTTGGGGATCCAAACTAAGAACATGGTAAACAGTATGATTCTAGATTCGGTCAGCCAACAGACGGAATCACAAGAAGACAACAGAGGTACCTTGATTAGGAATGCTCTCTTAAATATCAAAAGAGAGGTACATAGAAAAGGGAATGCAGATGTTTGGGCTCATAGTCAAGCTTTCCAATCAAAAGATAACTCACAAGGCTCGATTTCAGCAGAGTTTGACAGCACTGACAGTTTTGATGGTACAATTTTGCACTTTCATAATATTACACCATACAATGATGTCCGTGATTCAAGTCTGTTGTGGGATCAAGTGAATTTCCGAAACAAGGAATCTGAGTTTTGGACGGGTATTACTTTGGATGTGTCCACTCTGCCATTAGCAAGGCGATGCAATGGCATTTCCTGCAGTGCAGTATCAGCAGACAACTCTCTTGTGGCATTAGGTTCAGTGCAAGGTGACATTCTCATATGGGACTTATTACCTTTCCCACCACGCATACTCAGAACAAGCCGTGGTAGAAGCAAAGCTATAGTGCAACTAAAGTGGTCGATGGATGGTTCCCAAATTGTCAGCGTTGATGATCATGGAACTGTTATCATTTGGTCTCTGGGTGACACTGTATCAGTTCCTTTTGAGGTCAAGCCATTTGAACCAATTGAGAGGAATCTTGGTTTTAACACCACAGCTTTACTTCCTTTGTTAATCCTAGAGTCACAAGATTTCATCTTCAGAGAAGGTCCTCTTTCCAGGTCATACAAGTCAACAAGTAAGGCCACAGCTGTTGCCTTTCATCCTTCTGTTTCACTTCTTGGAAAACAAAGTTATTTGATGGTTGGTTTTAAAAATGGAGACATTCTTAGGATAAAGTACAGGACTTCATCATCTGTTATGTCTATACCACAGGTCAATCCAACCAATGGGATGCCTTGCAAGATAGCACGAGATATGCATGCTGAACTGTTCAAGTCACACCAGAATGGCATTATGCTGATAAGCTTTGTTAACAACATTTCTCCTATGGTAACAGTAGATGAGAAGGGATTTATCAACCTGTGGATATATTCCCATGAATCGCTATCAGGATTTGGCTGGTTTGTTCCAACTATCAAGTACAAGTTAGACATGTCAGAAGTGACATATGAGCCAGTAATTGGGGCACAGCAAAAAGTGGAGTTTACTGATGCTGTAAGAGGCCCAAATCGAAAAGAAACCCGTTTCAGGAAAGAGATGACTCAAAAGCGAGAAAGAGTTCATAAGTACGTTAGCTCTCTCAAGTTAGGGAAGCCATGGAAGACTGAAGAGAAGGGTGACATGGTCACTTATGTATTCACACCAAAGCATGTCCCTGAGTCTGGAGCAAAATTCCACAGTTTAACATATAATGCATCTTCAGGCTTGTTGTCCTCTTATGTTACCAGATCTTACAGACCCATCACAGTGCCATGTTCTCGGTTTGTGTCATGCCAGGTGGATGCCTCAGGGTCAAAGCTTGTGTTCATGTTGTTATTTCCAGAAGCTGACCCCAAAGGAGCCCATGTTTCATTTGTTATTTTGGACCTGGAGCCTTCAGTTGCAGTCAGCAAAAATTATATTAACATCCCCGTCAGCAAGAATGATTATGGGAAGTGCTTACACGAGGGTCTAGCCTTTGGACTTTCCTGGCCCGTAGATGCAACAGGGACCGGATATATTGTGGCAAATGTCAGTGGAAGTTTGACAGCCATTTCCATGACGACAGGCAATGTTGTCATGGCAAAAGCTGAACCTGGATGGACAGGATGTCAGCTGAATATCAAGAGAGGTTTGATTCCTTCAGTGTCCAATGTTCAAGTAGCAAGTGTATGTAACCGGCTGCAGATATTGTTGTATGCACAACGATGTCACTCTGCCATCTTGTTTCAACTTACAGATGGGAATACCCAAGAACAGCGGTTGGGGACTTGGAGGGTTTTCCAGAAATGGATGCTTTCTAGGGCAGATCGAAGTGCTGAGAAGATGCAAACCTCACTTCAGACAACGAGGCGCTTTCGCTGGAATTTTAAAGGGCATTATGATGTTCATGTCGAGTGCTTCATCGAGTTTTTGCTTTATGAAATGATTGATAATGCCATTCAAACTGTAGATGGTGCATTTAGTGGGAACCAAAGACGGATTTTTCATACTGAGAATATGACCGTGCCGTTCTTGCGAAAGGTGGCATCTCAGAATCCTGAAGAAAGCGAGTCTGAGACTGGGTCTGAGATTTCTGAAAGGTAG

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0010406 (this species only) · gene tree & orthology
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species

Pfam domain

No Pfam domain signature was recorded for XP_074619149.1 in Acropora palmata.

InterPro

InterPro term	Type	Description	Source
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR050687 all species →	Family	Dynein Intermediate Chain	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12442 all species →	DYNEIN INTERMEDIATE CHAIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005868 all species →	Cellular Component	cytoplasmic dynein complex	Interproscan
GO:0007018 all species →	Biological Process	microtubule-based movement	Interproscan
GO:0042073 all species →	Biological Process	intraciliary transport	Interproscan
GO:0045503 all species →	Molecular Function	dynein light chain binding	Interproscan
GO:0045504 all species →	Molecular Function	dynein heavy chain binding	Interproscan
GO:0097014 all species →	Cellular Component	ciliary plasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074619149.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074619149.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

55TPM > 0

2Conditions

14.6Max TPM

4.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	30	2.98	9.42
all_coral_tissue · baseline	38	25	5.47	14.61

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.42
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.63
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.46
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.36
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.58
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.31
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.12
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.11
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.11
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.13
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.92
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.47
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.37
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.35
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.16
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.09
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.02
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.99
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.50
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.41
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.21
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.07
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.94
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.85
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.70
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.59
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.51
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.46
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.11
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.99
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.61
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.94
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.03
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.27
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.18
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.16
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.15
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.01
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.85
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.67
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.50
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.22
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.82
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.62
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.49
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.06
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.45
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.27
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.94
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.66
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.97
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.75
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.32
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.05
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.85
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.