Gene detail

Detailed information of XP_074619293.1 in Acropora palmata

Genomic Location: NC_133885.1:15247299...15258073
NR annotation: XP_044177064.1, LOW QUALITY PROTEIN: uncharacterized protein LOC114971281 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074619293.1

ATGATTTCAGTGCACTTCTCCCCTTTTATTAACTCAAAAGGAATTATTGTAGATAGCAAGAATCAAACAGAAAAGAATTCCTCCGACAGACACCCCAGGAAGGACTTAGGTGGTTACATCTCGAACCATGTCAGACTTGAAAGCAATTCCACCCTTTATTTGGCTTCTTCTAATATTATCATTTTGTCGAATGCATCACTAACAGTTACACCTGGCGTGGAGATTCAGTTTGGTCGAAGTGCCAGCATTGTGGTTTTTGGCTCACTGTTTGCTCTCGGTACAGCAGAGCGCCGGGTGAAATTTACCGTCCTTAAGAAAGCGATAAAGAAACTCCCAGTTCCAGTTCGTTTGATTGGTGGAAAATACCCTTGGATAGGGCACCTAGAGGTTGCACACAGCGGCATTTGGGCGCCAGCTGCAGTCTGTGTTAACGATACTGGTTCGCTGAGATGGAATGACGCTGCAGTTGTTTGTAGACAGCTTGGTTACGAATCAGCATGGTTACTCACATGGGTAGAAGACCCATCCAATACCCGGGCATGGCATTTTAATTTCAGTTGCTTTGGAAGTGAAACAGACATTAGTAAATGTCCAATTACTTTTGAAAAAATCAAATGTAATCATTCTTACAATGTCATGATACTCTGCAGGGGAGGCCTCCCTTGGGGTAATGTACGATTCATGCGGGATAGCGCAGACTCAATCGCCTCTGGTATTTCAATATTGGAGCACTTGGACATTGAGCACTGTGGATATAGAAGCGGACAACATGCCCCAGCCGTCCAAGCTATTCATTATGTTCCGAAGATTAATCATTTACGTGTTGTGAATTGCTCTTCAGGGGGTCTGAAAGTTCTATATCCTGAAAAAGAATTCAAGGTGGCAAAAAGCTCCTTAATTAACACTGGGGGAAATGGAACAGAAATTGTAGGCGCTAAAAGCAGTGTAACTTTTGAAAATATCATCTCTGTCAATAACGAAAACGGGGTAACGTTTACCGACACAGACGCGAAAAACCTTGAAGGACTTTTTGATGGTCAAATTTGTTTGTGCGCTAAGACTGTCGTTGTTAACTTAACAAGAGATGAAATGTTTTTTTTCTTTAAAGTGCCGAACATAGACGCTGCAAATCCAACGATTAACTGTAAAAAAGTTATCCTCACAGACCCAGGTTACACGTTATCATTCAAGTTGTTAGTTCAGCAAAGAAATCAGTACTTGAGAGTCATTGACCCTGCTGGACGTGCCAGTATCCAAACAAACTACAGAGAAGAGCGTCAACGCTTAGAAGATCAACTCATACTGCCTTGGAATCGTGCAACGATTATTCTGAGCGGTTACTATGATGGTGAAGTACTTTTACATGTGAGGAGGGTTAGAGCTGATGATATCCCCTGCACGTTTGAGGAATATGCATGTAGCTGGCAAAACTACCCCAAAACGACTTTTCAGGGAAACACCTTAAACGCCAACTGGCTTCTCACCTATTCCAGTTATTATCACTATGCTGAAACTGACCATACATTTTCTACACGCCGAAATGGCCGATACATGCTCCATGGCGGCCGTTACTACAACAGAAGAGCGTACGCTGCGTTTATGAGCCCACCTGTCACGAAAGAGAACAACACGTGTTTCTTTGTCTTTTATTACAAGACCGGGAGAAGCGGACATGCAGAGCTCTCTGTGCTACTGGAAGAAATCCACAAAAATACCACCACAAATGGAACTTATAGTACACTGTTGTGGACCACGAATCGAACGGTCACCAACTGGAAAAGGCAAATAATAAGTCTTCCTCCGATGAGCCAAAAGTACACCATAGTATTTCTGGGTTACTACAAGTCTTTTTCGTATACGCAGCACAGCTATGTTGCAGTGGATGATGTACAGTTGATAAGCTGTGATGCATCACGGCGTTTCGTAAGATATCGTGTTACTGACAGCACTGTCAGCGGAAATCGTGGTCACGGAATTAGTTTCAAGTCAACTGAAACTAAAAGCAGTGTTTTCCAAATAGAACGATCCAAAATAACCAAGAATGGGTTACGGGCTACAGCTGGCAAAACATCACTGGAAGGTATTCATCTCAACGCAACAAATCAAGTGTTTACAATTACCAACAGTTACATAGCTGAGAATAAAAATGGAGGCATATATGCCGAATTGCAGAAGCAAGATATTCCGATAGCCCTATCTCACACCAACCACATTCATGGAAATACCATTGAACATAACAGGGGCAAAGCATTGTTCTTGCAGGGAAAGTCTGGGCAGCCCTCCAACGTTAAGCTGACGAATAAGTATGTTTCTTTCAACTTGGGAAAGAGTTTGCAAGCAAAAGCGACCACACAAACCGTTTGTAAGTTGTCCAATCTTTTCGTCCTACTTCAAGCAAATTTCTTCTATAACAACAGTGGTCAATATATCGTGGAATTTGATGGTAGTCAATCAAGCCTTAGGTTTATCAATAACACCTTGCTTAGAAACCGCGGATTAGGAGACAACTATGGCGTGACTTTCCTCTGTAACGGAGCAGCTGAGATGCACGGCAACGTCTTACAAAATCCTAACAACCGTTACCAGATTAGTACAACACTTCAAAGGATTCCTTTAACAGTCAATGCCACTTTAAACTGGTGGGGAGAAAGTACTCTAAATTTAGTCTCATCCCTAATAATGGATAAAACTGCAGACTACAGATTATCCCTAACAGTCGTCTTCAACCCGTTCCTACACTTGCCGCCAAGGAAGTCCGTCTCAGTTTCGTGTCCACCAGAATGGATGATAGAAGGTGAACTTTGCTATCTTTACAAGGGAGTTGCTTTTACATATAAAGAGGCTGAGGAATACTGTGAGAACTATGGTGGATTTGTAATGGATGTGGCATCAGTCGCGAACAGACGACTAGTGCAGCGTCTAAGATCTAGAGAGGAAGAGTCTTTGCTTACTTGGGAAAAACAAATGCCTACATTGTGGACTACGAAGGCATTTTCGGTCAATAGTGACAGATGCTTTACAGTAAATAACACTGGAGAAATTGAGGAATCTGACTGTGATAGACGTCATCCATTTGTTTGTACAAGACGACCAGGAAAAACGAGCTCCAGTCGGCCGCAGACAGATGCCTCTTCCACTCCGTTCACGCTCACAACACCGAAGACTTCAACTCCAAACCAGAAGCCAGAGAAGCCAAGTTATATTTCTGAGTTTACAAATCCGGCTACGGATCCAGTCACCAGTACCAGGTTCACAAGTCCCACTCGTCTTGTTTCCTCGCCTTTCTCAGAAGAAGCAACTAAATCTTCCCAGAAAAGTAAACATTTTATGGTGATTGGTTTGTCAGCATTTGGAGGAGTGCTGATGAGAGTGATCTTAGCCTTAATCATAATGAAAGTCGTTTGCAGGCGCAAAGTCTACCCTACAGTTGATTGCGAGCAGACTGAATTAAAAGATGAAATTCACGTCAACAAAGCATTCGAAATGTCGGATATGTCCGCAAAAACGTAA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000535 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13229 all species →	Beta_helix	Right handed beta helix region	Repeat	Interproscan
PF00629 all species →	MAM	MAM domain, meprin/A5/mu	Domain	Interproscan
PF00530 all species →	SRCR	Scavenger receptor cysteine-rich domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000998 all species →	Domain	MAM domain	Interproscan
IPR036772 all species →	Homologous_superfamily	SRCR-like domain superfamily	Interproscan
IPR011050 all species →	Homologous_superfamily	Pectin lyase fold/virulence factor	Interproscan
IPR039448 all species →	Domain	Right handed beta helix domain	Interproscan
IPR001190 all species →	Domain	SRCR domain	Interproscan
IPR013320 all species →	Homologous_superfamily	Concanavalin A-like lectin/glucanase domain superfamily	Interproscan
IPR016187 all species →	Homologous_superfamily	C-type lectin fold	Interproscan
IPR016186 all species →	Homologous_superfamily	C-type lectin-like/link domain superfamily	Interproscan
IPR006626 all species →	Repeat	Parallel beta-helix repeat	Interproscan
IPR017448 all species →	Domain	SRCR-like domain	Interproscan
IPR053243 all species →	Family	Septate junction maturation regulator	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47653 all species →	PROTEIN BARK BEETLE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074619293.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074619293.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

40TPM > 0

2Conditions

10.6Max TPM

1.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	18	0.75	5.93
all_coral_tissue · baseline	38	22	1.33	10.55

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.93
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.24
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.49
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.33
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.16
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.07
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.94
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.53
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.32
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.31
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.23
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.18
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.15
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.92
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.86
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.76
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.57
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.51
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.55
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.71
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.69
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.23
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.53
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.09
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.95
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.84
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.78
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.63
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.61
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.58
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.31
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.17
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.08
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.03
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.84
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.66
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.65
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.64
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.45
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.45
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.