Gene detail

Detailed information of XP_074619403.1 in Acropora palmata

Genomic Location: NC_133885.1:223703...237636
NR annotation: XP_029204735.2, LOW QUALITY PROTEIN: allene oxide synthase-lipoxygenase protein-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074619403.1

ATGATGGGTTCGTGTTCGAGTGCAGCAAGTACTCAGGGAGATGATCCAGTCGAGAATAAGGAATCCGCTCAAGAAATCAACAGGAAACAAGACAAGAAAAACATGACTGAATGGAAAAATCTTGGCTATGAAGTGTACAAAAGTTACATGGGGGAAGAGGCGTTCAAAAAAAAGATTGAAGAATTTGAAAAGCCGCTTCCTCCTCCTGGACTGTTTGACCAAGCAAAAATCAGGCACAACACTAACAAACTCAAGCTTCTCTTCGGTATGAAGGCCTTTGCCAGAAGTCAACGAGGTACTCATTCTGTTGGAGTCGGAGCCCAAGGAATCGCGACCATCGCACCTAATCCCCAGTTTCCTGCATGCGAGTTTTTCACTCCCGGACGCACTTTTCCAGTCTGTTTGCGTCACGCGACCATCGACTCAATTGATGACGTAAAGATTGATTTTTGTGGTGGTTCATTGAGGTTTGCATCAAGTGAGCACGATGAAAGCCCGTTTGACATTATCATGGGAACAGGACCCACCACACCTCTGTACAACGCTGGCGCAATATTTGATGCTGTGAGAGTGAAAATTTCAAATGATCTGAAAACGTATCTTCTACTTGGACCTGACCACCTTGTAGCAAACATCGGCGGACTGCGTCACAAGCCGGAGTCATTCTATGACCAACGTTATTACTCTAAAATGATTTTCGACTTCAAGGCTGATGATGGCATCAAGCGTTACGTTAGATTCCGCTTGATACCGGCGGATGGGTCACTGGAAACCGGTTTGTTGCCAGAGGACGCTCAGTGGGAAATTTGGAACCGAGATAAAAGGGAACCAGGTGAAACGTTACCACCCGATTATCTCAAGCGAGAATTTAAAGACCGAATGAGTCGAGGACCTCTTGAATACAAACTACAGTTGCAAGTACATCAGGCAAAGAACGACGATCCTTCCACGATACTACAAGTCGGCAGGGAATGGGACGAGAGTACGCATCCATGGATGGACTTGGCTGATATCAAAATGACGTCCCTACTATCTCCAAAGGCAACCGAACGGCTTAAGTTTACATTTACTCATCTCCCTCCTTGCATTGGTATATTACCCGCCCAGTCTGTCGATGATCCCAATGTTGTCGTTCAAATCCGAAAAGAGGTGTACATGTGGTCTCAGGGTTTGCGTTCCAAGAGATCCAATAAGGTTGTTCCCGATCACATGGCATCCTATCTCATCCGGGTGGAAACTGGGAGTCAGTCAGGAGCAGGAACTGATGCTACTATTTCTATTTCAATAACGGGCACTAAAGGAAAGACTGACATGATTAAGTTAGACAATTGGGGCAATGACTTTGAAAGAGGAGATGTTGATGATTATTCTGTGGAAGCGATGGATGTGGGTGAGATACTAATAGTACACCTTCACAATGATGGCGGAGGATGGTGGCACAAGAATCCTGATTGGTTCGTTAACAAGATCTCGATTATAAGTTCCAAACAGGTGCAGGATGATCCATTTGAGTTCCCTTGTTATCGCTGGGTGATGTCTGATTTGGTCGTATTTGAAGGAAAGGCTACCCTGCCCTTCCAAGAACTTCCCTCGGCGGTAAAAAGTCAACGCCTTCTTGAGCTGCAACAGCGAAAGGACAATTACAAGTGGGACAAATCAAAAAACTTTGAGGATGTTCCTGGCCATCTACAGGCTGCCACATACAAAGATATCCCAAGAGATTCGCAGTTCTCCAATGAGACAAGGGAATCGATCGATGAAAGCAGAAAGAATGTCACCCGAAAACTTGGTCTGGCTCACCTGTTAACTCTATTCGAAAGTTGGGACAATTTGGATGATTTCCAAAAGATCCTTAAGTATTCTTACGGTAGAGTGCCAAGAATTGTCGAAGATGACCGATGGAAGACCGACACTGTGTTTGGATGGATGTTTCTGAATGGTTGTAATCCAAATATACTCGAGAGATGTGAAAAATTGCCTGACAATTTTCCTGTCACTGAAGAGATGGTACAGCCAGCCTTGGACCGTGGCCTTACATTTGAACAGGAATTCAAGGAGGGGCACTTTTACCTTGCAAACTACAAGGATCTTGAAGGGGTCCCATTCACCGGAGGAGAAGATGAGACTGGTTATACTGCAGAGCCCCTGGCGCTTTTTTACGTTAAGAGCTCTGGCGACCTGGTGCCTGTTGCTATTCAGCTATCACAAGAACCTGGTGACACTAACCCAATATGGACACCTTGTGACTCGGAATATGATTGGCTGCTGGCAAAAATGTGGCTACGTAACGCAGACTATTATATTCACCAGATAATCAATCATATCCTCAAAACGCAGCTGTCGATGGAAGCGTTTGCTGTGGCTGCATGGCGTCAGCTACCTTCAGTCCACCCAGTGTTTAAATTGCTCTTCCCTCATCTGCGTTCTGTGATGGCGATTAACGATTTTATCAGAAGGGCGTTTTTAAAGACAGATGCTTCCCAGGTTCTTCTTAAGAAGTCGTACAAAACGTTTGCGTTTAAGATGCTGTCTCTACCTCAAGTTTTGAAAGAGAAGGGTGTGGATGATGTTGTGAAATTACCAAAGTTCTACTACAGGGATGATGCCCTTTGCTTGTGGAAAGCCATTGAAACATTCATCCGAGAAGTGCTCTCGATTTCGTATAAGTCTGATGACGACGTTTCCAACGATACTGAACTTCAGACCTGGGTGCAAGACATTCTAGAGAATGGCTTTCCCGTGAGAGATGGTAAAGGTGGACATGGATTCCCAGAAGACCTTTCAACACTTGACCAGCTTGTTCACGTGCTAACGTGCGTAGTGTTCACGTGCTCCTGTCAACATGCTGCATTGAACTTTGGACTAATGGATGCACACAGTTTTGTTCCTTTCACTCCTTCGATTATGCGCTTGCCACCACCAACCAAGAAAAACGAAGCGACTTTAAACTCAATCATTAATACGCTTCCTAACAAGTCACAGGCCTCTCAACAAATTGCTTTGATGTACGTGCTGTCCCAATTTGCTGAAGATGAGCGATTCCTTGGTGACATGACACAAACTTTACTGACTGGTAAAGACGCAGAAGATGCAATAAGTCGTTTCCAGACCTCTCTTCAAGGAATTTCAGATTCCATCAAGACTCGCAATGCCTCACTTGAATTGCCTTACATCAACCTTCTCCCTGGACGGATTCCCGACAGTATTGCTATTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O16025	Allene oxide synthase-lipoxygenase protein OS=Plexaura homomalla OX=47982 PE=1 SV=1
P09917	Polyunsaturated fatty acid 5-lipoxygenase OS=Homo sapiens OX=9606 GN=ALOX5 PE=1 SV=2
P48999	Polyunsaturated fatty acid 5-lipoxygenase OS=Mus musculus OX=10090 GN=Alox5 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000523 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00305 all species →	Lipoxygenase	Lipoxygenase	Domain	Interproscan
PF01477 all species →	PLAT	PLAT/LH2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036226 all species →	Homologous_superfamily	Lipoxigenase, C-terminal domain superfamily	Interproscan
IPR013819 all species →	Domain	Lipoxygenase, C-terminal	Interproscan
IPR001885 all species →	Family	Lipoxygenase, mammalian	Interproscan
IPR020835 all species →	Homologous_superfamily	Catalase superfamily	Interproscan
IPR001024 all species →	Domain	PLAT/LH2 domain	Interproscan
IPR000907 all species →	Family	Lipoxygenase	Interproscan
IPR020834 all species →	Conserved_site	Lipoxygenase, conserved site	Interproscan
IPR036392 all species →	Homologous_superfamily	PLAT/LH2 domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11771 all species →	LIPOXYGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016702 all species →	Molecular Function	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0005506 all species →	Molecular Function	iron ion binding	Interproscan
GO:0020037 all species →	Molecular Function	heme binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0034440 all species →	Biological Process	lipid oxidation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26082	AOS; arachidonate 8-lipoxygenase / allene oxide synthase	EC:1.13.11.40 EC:4.2.1.-	Arachidonic acid metabolism	ko00590	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074619403.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

73TPM > 0

2Conditions

120.9Max TPM

34.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	39	35.33	120.87
all_coral_tissue · baseline	38	34	34.04	63.86

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	120.87
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	99.06
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	75.58
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	69.83
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	67.94
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.78
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	59.08
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.90
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.36
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.94
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.88
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.46
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.82
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.03
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.79
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.62
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.38
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.20
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.94
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.07
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.42
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.56
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.53
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.94
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.38
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.31
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.24
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.80
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.70
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.60
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.17
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.18
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.63
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.12
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.80
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.52
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.33
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.65
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.64
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.86
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.35
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.14
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	59.65
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.71
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.80
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.53
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.29
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.80
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.93
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.92
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.87
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.56
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.43
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.28
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.27
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.26
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.26
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.75
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.10
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.25
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.76
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.17
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.01
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.29
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.90
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.31
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.85
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.96
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.92
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.35
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.68
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.12
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.