Gene detail

Detailed information of XP_074619636.1 in Acropora palmata

Genomic Location: NC_133885.1:20590867...20609633
NR annotation: XP_048589505.1, uncharacterized protein LOC5519234 [Nematostella vectensis]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074619636.1

ATGTATGGATTCGTACATTGCGCTCTCGCGGATCTCGTGATTAGCAAGTTTGGCCAAGATGTTTGGCTGTCGATAATTGAGAAAGCTGGTGTGGAACTCGATGGAGGGTCATATCTAATTCACAAAATCTATGATGACCAAGAAACTCTAAGCTTAGTCGCAGCGGCTTGCGAAACCTTAGATCTTGATTTAAATGATGTTTTGGAAGCGTTCGGGGCCCATTTTCTGGCCTATTGTGTTCAGTCTGGTTATGACCGGATTTTGAAAGTCTTAGGAAGAAATTTACGGGATTTTTTATGCAATCTGGATGCCCTTCATGATCATCTTGCCACAATCTACCCCGGGATGGAAGCGCCTTCATTTCGCTGCAGCGAAACAACAGATGGAACATTGCAGCTTCATTATTATTCCAAACGGCCAGGACTCGAGCATATTGTTATCGGCATTGTCAAAGCGGTTGCAAAGGAAATGCTCAACACTGAAGTCGCAGTGAAGGTGCAGCAATCCCGATCAGAGGGTTGTGATCACGTTGTGTTTGCCATCGTCGAAACGGGTTGTAAAAGCGCGGAACATTCCAAACTTGGCTTGCAGAATTTTGATTTAAACTCGCGGACTGATAAACAAGAATCTAATACGAGAGAGAGTGAAAAAATCGGGAAAAGACGACGGAAAGAAATCAATCTTTTATCGTTTTGCAAGGCGTTTCCGTTCCACGTTATGTTCGATAGAAAACTATGCGTTACTCAAGCTGGTGTCGCGATGACAAGGGTTCTAAACAAACGCTTCACTATTCCTTTCTTGTTTAAAGATGCATTTGAGCTCGCTCGACCGCGCATGGAGTTCACATTTGACGCTGTTCTGTCTCATATAAACACAGTTTTCATCGCTACCGTTAAACAATCCGCGTTAAGAATGAGTGCTGATCCGCCTCTCAAGGTGGTATCAAATTCGGATGTAGGCCAAACATCTGGAAACGCTATGCCGGAGTTGCGTCTCAAGGGACAAATGATCTTTATACCCAAGAACGATTGCATTCTATTTTTGTGCTCTCCTCGGGTTTCCAGTGTGAGTTTTTTCAAACAGCTCGGAATTTGCTACAGTGATATTCCAGTTCATGACGCCACGCGCGATCTTATCTTCATGTCGCACGCGAGGAGAGCCGAGAGAGAACTCGTGGAACGATTGGAGGAAACAAGCAACGATCTTCGAAAACTTGAAAGCAAGTTGACAGAGAATAAAAGAAGAACTGATGAATTGCTACATTCTATCCTTCCCAAAGAGGTGGCGGCGAAACTAAGATTAAGCCAACCAGTCCCAGCGGAAAATTACAAGATTGTTACAATTTTATTCAGTGACATTGTTGGTTTTACTGCGCTGTGCTCTGACGACAAAATTGTACCCATGGACATCGTGAGGATGTTGAACAAACTTTACACTTATTTCGACATGCTCACCGGTATGAACGACGTTTACAAGGTCGAGACAATTGGTGACGCTTACATGGTTGTTGGTGGTCTGCCGAAGCCTTGTGATAACCATGCTGAAAAAGTGGCTTACATGGCGTTATCAATGATGGAGGCTGCGCGCAAAGTGCTCTCGCCAGTTGACAAGGAACCTATCAAGATTCGCATTGGAATCCATTCTGGCTCAGTAATGGCGGGTGTTGTAGGGAAGATGATGCCCCGTTATTGTTTGTTCGGGAGTACTGTCACTTTGGCAAACAAGATGGAGTCCGGCAGCAAACCAGGTTTCATAAACGTCAGCTGTGAGACAAAACGTTATCTTCAGAAGTCTAAAGAGTTTGAATTCACTCCCAACACCGAGATTCCGAATCCAATGAGCTGTTTCTTCCTTACAAGGAGCAAATTCGCGGAGAGAAAACCTTCAATTATCGACATTGCGGCTTCCGTTGCACCCAATAACATTTGTATGTTCCGATCGCCGAGGACCTCTCCTTCCCATTCTCCCCCGTCCAAGCGTAGAAGCGAGACAGCACCAGCGGACCTGCTCTCCTCGAACTTGGACAAACCGCCCATGAGGAGAGTGAGTTCAATCGATTCTGTATCGATTAACGAGAAACTGGAGAGTCTCAAACGACAAGAAGAGGGTAAAAGCAAGAAGCGACGCACTACTCTGGCAACGTTGTGTCCGATGTTCAAGCCTAGCCACTTCAAACAATCTGAGAGCATAGACGAAAACGACAACGAACAAGAAGAAGAAGATGATCATGATGATGAAAATGGTAAAGGCCAGATGAACGGTGGAGCTTCTTTGATTGGATTGGATGAGGAATCTTTGACGGAGCTCGTTCAGCTTACTCAAAAGATAGATTCCACATCAGCTTTAATTTTGCGACTCGCGTTCACCACTCTTGTAAAAATGTACGGTTTTGTAAACCAAGCGTTACAAGAGTTTGTGATTCGGGAAAGCAGCTTTGAAACTTGGAACGAGATTATGAAGAAAGCTCATCTCGACCTTGGAGAAACTGGAGAATTCAACCAGCGACGAATCTATGATGACCAAAACACATTTGATCTACTGCGAGTTGTCTCGGAAGTTCTTGGTGTATCAGAAAATTACGTCTTAGAGAAGTTTGGAGAGATATTCTTTGAGCATATCCAAGATGCTGGCTATGAAAAGATGCTTGAAAACTTGGGAAATAATCTCAAAGACTTCTTTAACAGTTTAGATGCAGTTCACGAGCATCTCCTCTATGTATTTCCTGGCTTACGAATGCCTTCATTTCATGCCAAAGATACCCTTGATGGCTGTGGCATAGAGCTCCTTTACTATTCTGAAAGAGCAGGACTAGAGTACATGGTGGTTGGCATGGTTAAGGCTGTTGCAAATAAAGTTTTCAACTTTAAAGTGAATGTGGAAGTTTCTGTACCAACAAATGAGAAATCAACCTGGTCAAGACTTGTCATCACAACTGATAATACCACAGATGTTGCTCTTCTCAAGCAGCATGACAAGCAAATACAAAAAATGGAGCAAAAATTGGAAGTGGTCACTTTGAGCTCTCGAATCTCCTCTCAAACATTCTGTCAGGCATGCCCATTCCACATAATTTTCGACAACAAAATGGTTATCTACCAAGCTGGCTTATCCCTTAGGCGTGTTTTACCCTCTGTCAAAGTTGGAGAAACCAAACTTGATGAGGTTTTTGAAGCCATCCGCCCACACATTGAGTTGGCATTTGACGATATTCTGCAGTTTATTAACAAGGTGTATGTCGTCAAAACTAAAGAAGGACTCCTGGATTCGGCCACTTTAACGACTGTCTCGGAAGATGATATTGTATCACTGGAATCACCAACCATGCGTTTCCGTGGGCAGATGCTATACCTTCCTGAATGTGACAGCATCATGTTTCTGTGCTCTCCAAGTGTTCTGAATTTGGATGGCTTAAATGAAATAGGCCTTTACCTCAGTGATATTCCTATCCATGATGCAACAAGAGATCTCATTCTGCTGTCAGAACAACACAATGCTGAGTCACGCCTGTCTCAGCGTCTTGAAATCCTGACAGATAAGCTCCAGCAGACAGCAAGAGAACTTCAGCAAGAACAGCAGCTCACTGACCGGCTTCTCTATAGCATTTTACCTTCCTCTGTTGCAAACGACTTGCGCCTGAAAAGACCCGTCATGGCCAAGAAGTACGAGTTGGTAACAATCATGTTCAGTGGGATTGTAGATTTCACCCATTACTGCAATCAGAGCACGGAGCCCATGGAAATTGTGCAACTTCTGAATGAAACTTATACCAAGTTCGATCAGTTGGCAGACAAAAACAATGAAGTTTTTAAGGTTGAAACAGTGGGAGACAAGTACATGGCTGTTAGTGGCTTGCCGACAAGATGCTCAGGGCATGCAATCAACATTGCTAATCTTGCCCTTGATATGATCGACATAGTCCAGGAAGTGAACACTAATGGAAGGAAAATGCAGATTACAATTGGTATTCACTCTGGTGAGGTGGTTGCTGGGGTTGTTGGACAAAAGAAGCCGCGATACTGTTTGTTTGGAAATACAGTTAATCTTACAAGTCGCACAGAAACCACTGGGCTTCGAGGAAAGATAAATGTGACAGAATACACTTACAGATCATTATTATGCGAACCACACCACAACCTGGTGTTCAAGAGGCGAGGTGCCGTTACTATGAAGGGAAAACCAGAACCGATGATCACCTACATTCTCCAAAGAAATGACGAATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O54865	Guanylate cyclase soluble subunit beta-1 OS=Mus musculus OX=10090 GN=Gucy1b1 PE=1 SV=1
Q4ZHR9	Guanylate cyclase soluble subunit beta-1 OS=Canis lupus familiaris OX=9615 GN=GUCY1B1 PE=2 SV=1
Q02153	Guanylate cyclase soluble subunit beta-1 OS=Homo sapiens OX=9606 GN=GUCY1B1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001319 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07701 all species →	HNOBA	Heme NO binding associated	Domain	Interproscan
PF00211 all species →	Guanylate_cyc	Adenylate and Guanylate cyclase catalytic domain	Domain	Interproscan
PF07700 all species →	HNOB	Haem-NO-binding	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR024096 all species →	Homologous_superfamily	NO signalling/Golgi transport ligand-binding domain superfamily	Interproscan
IPR011645 all species →	Domain	Haem NO binding associated	Interproscan
IPR018297 all species →	Conserved_site	Adenylyl cyclase class-4/guanylyl cyclase, conserved site	Interproscan
IPR042463 all species →	Homologous_superfamily	Haem NO binding associated domain superfamily	Interproscan
IPR001054 all species →	Domain	Adenylyl cyclase class-3/4/guanylyl cyclase	Interproscan
IPR029787 all species →	Homologous_superfamily	Nucleotide cyclase	Interproscan
IPR011644 all species →	Domain	Heme NO-binding	Interproscan
IPR038158 all species →	Homologous_superfamily	H-NOX domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45655 all species →	GUANYLATE CYCLASE SOLUBLE SUBUNIT BETA-2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004383 all species →	Molecular Function	guanylate cyclase activity	Interproscan
GO:0006182 all species →	Biological Process	cGMP biosynthetic process	Interproscan
GO:0009190 all species →	Biological Process	cyclic nucleotide biosynthetic process	Interproscan
GO:0016849 all species →	Molecular Function	phosphorus-oxygen lyase activity	Interproscan
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0008074 all species →	Cellular Component	guanylate cyclase complex, soluble	Interproscan
GO:0019934 all species →	Biological Process	cGMP-mediated signaling	Interproscan
GO:0070482 all species →	Biological Process	response to oxygen levels	Interproscan
GO:0020037 all species →	Molecular Function	heme binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12319	GUCY1B; guanylate cyclase soluble subunit beta	EC:4.6.1.2	Circadian entrainment	ko04713	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074619636.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

72TPM > 0

2Conditions

40.6Max TPM

15.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	38	12.65	40.57
all_coral_tissue · baseline	38	34	18.32	31.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.57
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.39
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.23
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.21
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.58
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.16
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.26
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.44
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.18
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.11
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.66
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.02
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.98
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.37
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.31
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.29
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.04
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.00
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.72
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.05
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.26
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.86
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.57
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.98
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.90
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.72
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.47
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.42
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.82
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.82
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.21
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.04
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.12
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.99
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.58
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.57
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.94
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.00
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.56
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.26
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.83
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.70
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.39
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.22
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.74
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.35
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.13
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.05
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.85
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.17
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.48
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.05
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.96
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.76
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.64
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.74
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.53
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.43
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.12
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.60
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.98
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.08
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.67
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.28
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.71
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.60
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.09
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.04
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.58
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.39
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.29
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.