Gene detail

Detailed information of XP_074619948.1 in Acropora palmata

Genomic Location: NC_133885.1:1971867...1985204
NR annotation: XP_015751126.1, PREDICTED: ubiquitin-protein ligase E3A-like [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074619948.1

ATGTCGAAAAATAATTGGAGCAAACATTCAGATGGAAATGATCATACAGACATGAAGCGAGCAGCTGGACAGATGATAAAGAATTATTTTTTCCAACTTACTGATGGTTGTGGCTCAAAGGAATGCAGCAATGAGTATTGCGCATCAAGTGGAAGAAAACAAACATCAAAAGATGATGCTGCTGCCCTGGCCATTCAGTTATTTATGAAGAAGGCGCGTCTTTGTGAGCCTTGGCAACAAAGAAATCAGATAGAAGTCCCCCATTTCACAGAGAAGATTTTGTTGTCCAACTTGAACTCTTGCAAGGACAAGGGAGACTTCAAGAAACTTGTTCACAGCATAGGAGATGTATTCTCCAGCTCCAAATCACTCAATGGAAGTTTCCTATTAGAGAATTCCTCAAAATCACCACATGATCTAACCAATGTTGACATAAATGCCGTGCGCCGTTGTTATGCAGCACTTTTCAAGACAGATGATTCGTCAGTGGAGAATTCTTTGATAAATTCTCTTTCTGCTTTATCGCCTACAATTGAAATGGATCTGAGGTATAATTCTCCGAGCAGTGACCCCAATTTCTTGAACCAGTTTGTAATAATAATGGAAAACACCATGCTTCAGAGTCCAGAGTATCTGGACCAAGCCCTGCCTAGTTTCCTCAAGGCTATGGCATTACTTCCTGTCAAAATGCAAGCCACCTTGGTCCGTATTTGGGCACAATTTAGCAGTGTGGAGATCCGACGTATGGTAGAAACTGTACAGCAGTTGATCACCTACCAAGTGTTAACGGGACCCAGCACCACCAGCGGCTCACCAGTACAGGATGATGAAGTCATTGTAGCTGCAACCAAGGTAATGAAACTGTTCTACTGTGCTAGCATGTTGGGAGGAACCTTTGATGAAGCGTATGGCAACTCCCAAGATGATGCTAATTTGTCCAAAGGACCTGCTGACCCACTTCTGAAAGAACTGGATATTGAAGTACTGGACTGTCGTCAACCATTAGTTAAATTTGAAGAATTCATTAATGAGGCATTGAATGATCAAATTGAATTGGATAGAGACTATACCTACTTTAAAAGTGACTCACAGAGCAGGTTTGCATTTCTGAAGTACAACTTTATCCTATCCACGGCTACAAAGAGCATGGGTTTGTTTTATGATAATCGGGTACGTATGCACAGTGAAAGGCGCTTAACACTGCTTTACAGCCTTGTGAGAGGTCAGCAGCCAATGCCATACCTCAGACTTAAAGTGAGAAGGGATCACATAATTGAAGATGCTCTTGTTAGTCTTGAAATGACATCTCAGGACAACCCTGTTGACCTTAAGAAACAACTCTACGTGGAGTTTGAAGGGGAACAAGGAATTGATGAGGGAGGTGTATCCAAGGAGTTTTTTCAGCTGGTTGTGGAAGAAATTTTCAACCCTAACTACGCAATGTTCACATTTGACGAGATCACACGTTACTGCTGGTTCAGTTTAACCTCGTTTGAATCAGACGCACAGTTTTTACTGATTGGATTGGTGCTTGGTCTCGCTATCTACAACAATGTGATTCTCGACATTGGTTTCCCTATGGTGGTCTACAGAAAGCTGTTTGGACGAAGGGGAACATTTGCAGATCTTAAGGATTCCCACCGTGTTCTTGCTTCTGGTCTGCAGAATCTTTTGGATTATGATGGTGACGTTGAGAATGATATGATGTGTACTTTCCGCATCGGCTACACGGACATGTTTGGTTCGTCATTCTCCAAGGAACTGAAAGAAAATGGAGCAAATATAGCTGTTACCAAGGAAAACAGAAGGGAATTCGTCGAGCTTTACGCTGATTTCATCCTCAACACGTCCGTGGAGAGGCAGTTTAAGGCCTTCAAGCGTGGCTTTGACATGGTAGTGGAAGACTCACCTCTCAAGTCATTCTTCCGTCCAGATGAAGTGGAATTGCTAGTGTCCGGCTGCCAGGACTTTGATTTTGATGCATTGGAAAAGTCGGCTGAATATGACAATGGACTCAGTAGAAGCTCCACCTTAATCAGATGGTTTTGGGATGTGGTGCGTAGCTTCACAATGGACCAGAAAAAACAACTGTTGATGTTCACAACTGGAAGCTACCGAATTCCTGTGGGAGGCTTATCCAAACTCAAGCTTATCATTGCCAAAAACGGACCCGATTCCGACAGACTTCCGACTGCCCATACCTGTTTTAATGTTCTTCTGTTACCGGAGTACTCGAGCATGGGAAAGTTGAAGGAGAGGTTACTCAAGGCCATCACACATGCTAAGGGATTTGGGCTGTTGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O08759	Ubiquitin-protein ligase E3A OS=Mus musculus OX=10090 GN=Ube3a PE=1 SV=2
Q05086	Ubiquitin-protein ligase E3A OS=Homo sapiens OX=9606 GN=UBE3A PE=1 SV=4
Q8CDU6	Probable E3 ubiquitin-protein ligase HECTD2 OS=Mus musculus OX=10090 GN=Hectd2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004925 (this species only)
Ubiquitin family	E3\|E3 activity\|HECT · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16558 all species →	AZUL	Amino-terminal Zinc-binding domain of ubiquitin ligase E3A	Domain	Interproscan
PF00632 all species →	HECT	HECT-domain (ubiquitin-transferase)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035983 all species →	Homologous_superfamily	HECT, E3 ligase catalytic domain	Interproscan
IPR042556 all species →	Homologous_superfamily	Ubiquitin-protein ligase E3A, N-terminal zinc-binding domain superfamily	Interproscan
IPR000569 all species →	Domain	HECT domain	Interproscan
IPR032353 all species →	Domain	Ubiquitin-protein ligase E3A, N-terminal zinc-binding domain	Interproscan
IPR044611 all species →	Family	Ubiquitin-protein ligase E3A/B/C-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45700 all species →	UBIQUITIN-PROTEIN LIGASE E3C	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0000209 all species →	Biological Process	protein polyubiquitination	Interproscan
GO:0006511 all species →	Biological Process	ubiquitin-dependent protein catabolic process	Interproscan
GO:0061630 all species →	Molecular Function	ubiquitin protein ligase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10587	UBE3A, E6AP; ubiquitin-protein ligase E3 A	EC:2.3.2.26	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074619948.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

75TPM > 0

2Conditions

65.2Max TPM

37.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	34.31	65.20
all_coral_tissue · baseline	38	35	40.42	56.49

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.20
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.56
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.22
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.79
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.98
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.43
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.29
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.14
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.93
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.18
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.88
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.91
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.75
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.53
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.85
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.97
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.19
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.62
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.37
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.34
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.44
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.28
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.87
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.75
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.59
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.08
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.88
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.35
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.08
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.22
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.84
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.81
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.61
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.04
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.99
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.63
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.57
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.78
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.87
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.33
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.49
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.70
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.32
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.13
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.62
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.21
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.20
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.40
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.06
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.21
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.97
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.80
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.41
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.99
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.83
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.52
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.43
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.45
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.21
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.00
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.86
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.45
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.33
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.26
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.11
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.24
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.59
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.41
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.89
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.41
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.58
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.92
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.49
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.08
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.49
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.