Gene detail

Detailed information of XP_074620101.1 in Acropora palmata

Genomic Location: NC_133885.1:8714432...8721134
NR annotation: XP_027036168.1, uncharacterized protein LOC113664739 [Pocillopora damicornis]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074620101.1

ATGGACGAAGAAGCAAGTTCTGTTGTTTTACTCCCCGAAGTCAAAGTCGAACCTTTTGAAAATTCCACCAATCAAGCTGACAGTGAGGAAAGCTCACTGGGAAGTCCAACAGACGAAAATTCACTGCCCCGTTTTGGCGAAACCTCTGAAGAGGATATTCAAAGATTATTGGAGCACCGCTCTTGCAGTGAAAACACTTGGCGAGCCACAAAAAATGCTGTAAAAATTCTGCGAGACTACATGGAAGAGAAAAGTATGGATGTTAACTTTGAGAACTTAGACAAGCAAGCTTTGAATGACCTTTTGCGCAAGTTTTACGTTGAAGCGCGGAAAAAAAATGGAGACTACTACAAATCTTCTGCTTTGGGAAGTATCCGTTTTGGCATTCATAGGTACTTACAGTCCCAACAGAGGAATATAGACATTAGAAACGATCCTGAATTTACAGAATCCAATAAAATTTTCAAAGCTCAGGTAATAAAGCTAAACAAACAAGGAAAAGGGGAAGTGAACCGTTCAGACATCGGACCTGATGATCTTAAGAAGCTTTATCTCAGCGATGTGTTGTCGCCATTCAGCGCCGATGGTCTTCAGCGTAAAGTGTTTTTTGATCTCCTCATGTACTTACCTGGGAAACGCAATCGCAGCAATGTCAGAGAGCAAACTCGTGATACTTATCTCATCGGATACGATTCTAGTACGGGCTTGAAATACGTTTATCCAAACCCTTCCCATTGTGAAAACGTTTTTGCTGAAGGAAAATGTCCCAGGATGAACGAAAAACCAGGGAATCCCAGATGTCCAGTGTCCTCATTTCTCAAGTACTTGTCTAAGCTGAACCCGATGAATTTGTACCTGTGGCAGAGACCCAAAGCTTCATTCAAACACCATGCTTGTGAAGATGATCCTGTCTGGTATGAGAATGCCGCCGTCGGGCACAATTCACTGGGTGAGATGATGACTAACATGTCTAAACTTGCTCGTTTGTCAAGAATATACACCAACAACTGCATCAGAGGCACCTATGTAGCAATTCTTGACAGCCTTGTGGATGACTATCCTCTTATTACCACTCTAGTATCTCTGCCAGCTCCACAGAAATATCAACACATCCTCCCTCGAGACCCCTGCGATGAGCGACCTACCATGGTGTCAGTTAATGGGAAGTATCGTGCCTCAAGCCCAGATGAAACAGCTACCTCTAGATGCAATGACAGCCAACACAGCCTGTCAGCTTTCAGTGCCGTTACCAGCAGGGAACAAGCTCATCTTCCAAAGAGCAGTATAAACGCCAGTCATCCTTCACATACAAGCAGCAATGGCCTATCCTCACACACTACCAACTCCCCTATTAGCGAGAAAGAAACAGAGTTCAAACCAACAAACCCAGTGGAATTGCCAATGCTTGGAATGCGGTTCTACTCCAGCCAGAAAGAAATGCAGTCATCTTTGGCAGCCTACAGATTGAGCCAGCTTCAAGCATGCTCCTCACACCATCTTCGCAGTCCGCTTCACTTATCAGTCAGAAATAATGAGGGCAGTTACTGCTTACCTCATGCATCACTTGCACCTGTGGGTTCTGGAAATAAGTATTCAGGACACACGGGCTCAAAAGTTGTTTACTGTCAAACATCTCCAACCATGGCATCTTCTTCATCACACACCTTGCATTCTTGCAGTGACAAAGTCTTGATGACAGGAAGCCCCCTTACAACTCATGTGTTGGATACAGCAAGAGGCATTCCAGCCAGGAATGTGCAGATACAGCTGTACTTTGAAGAACTGAGACCAGATAGTCGAATGTGGAAACACATTGCCTCAGGAGTTACCAATACTGATGGGAGAGTTACTGATCTGCTGTCCCAAGAACAGTTTGTACCTGGTAAATACATGATGAGATTTGAGACTGAGGCTTATTTCAAAGAGACTGGAGTGTCTTCCTTCTTTTATCCATATGTAGAGATTGTGTTCCTTGTCAGTGAACCATGCCAACATTACCATGTACCACTTCTGCTCAGTCCCTTTTCCTACTCAACTTATCGTGGCAGTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q06S87	5-hydroxyisourate hydrolase OS=Danio rerio OX=7955 GN=urah PE=1 SV=1
Q9CRB3	5-hydroxyisourate hydrolase OS=Mus musculus OX=10090 GN=Urah PE=1 SV=1
Q21882	Probable 5-hydroxyisourate hydrolase R09H10.3 OS=Caenorhabditis elegans OX=6239 GN=R09H10.3 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008292 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00576 all species →	Transthyretin	HIUase/Transthyretin family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014306 all species →	Family	Hydroxyisourate hydrolase	Interproscan
IPR023416 all species →	Domain	Transthyretin/hydroxyisourate hydrolase domain	Interproscan
IPR000895 all species →	Family	Transthyretin/hydroxyisourate hydrolase	Interproscan
IPR036817 all species →	Homologous_superfamily	Transthyretin/hydroxyisourate hydrolase domain superfamily	Interproscan
IPR023419 all species →	Conserved_site	Transthyretin, conserved site	Interproscan
IPR023418 all species →	Binding_site	Transthyretin, thyroxine binding site	Interproscan
IPR052787 all species →	Family	Mitochondrial antiviral-signaling domain-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21446 all species →	DUF3504 DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006144 all species →	Biological Process	purine nucleobase metabolic process	Interproscan
GO:0033971 all species →	Molecular Function	hydroxyisourate hydrolase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074620101.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074620101.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

61TPM > 0

2Conditions

13.2Max TPM

4.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	33	3.74	13.21
all_coral_tissue · baseline	38	28	6.11	13.01

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.21
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.66
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.38
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.32
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.31
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.02
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.99
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.50
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.25
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.98
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.87
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.55
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.45
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.39
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.23
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.18
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.90
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.85
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.48
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.42
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.36
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.11
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.99
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.96
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.88
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.82
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.81
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.37
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.36
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.28
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.68
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.21
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.21
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.01
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.91
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.94
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.35
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.99
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.53
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.16
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.84
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.58
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.41
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.06
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.81
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.45
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.29
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.19
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.63
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.59
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.47
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.27
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.93
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.87
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.43
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.03
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.91
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.44
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.31
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.54
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.18
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.