Gene detail

Detailed information of XP_074621077.1 in Acropora palmata

Genomic Location: NC_133882.1:1892224...1926121
NR annotation: XP_044165488.1, golgin subfamily A member 2-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074621077.1

ATGGCTGATGCGGATCGAGAAGAAAAGTTGGCTGCGGCCAGAAAAAAGCTGAAGAAATTTCAACAGAAGCGGACGCCGTCAAGCCCCGTGGTACGTGATTTGAAAGCTCCACTTTTAAACTCCTCTAGTAACGTGCCTAATTCAGCAGAATCAGCGGAGATTCCGTTAACAACAAAAAATGATGGAGATGTCAATCCACATGAACAAGCTTCAGGTTTGTCATCACCACAGCCAATCAATGGTGCACACAGTCCAGAAGATCACAGCTCTCAAAGACATCTTACACTTGAAAGCAATCATAGGGAATATTCGACCACAGAAAAAATCAAGCAACTTTGTACACAAATTAATGGCCTTATGAATCAGGATTTTTATGTTAATGGTGAAGACCCAGTGTTTCATGAGATAGAATCTCTAGAGCATAGAAATCATGAACTGGAGGAGAAAATGCAATCCTTTAAGAGATCAAATGACCAGCTGAATACTCAAGTCAATGATCAGAGACGACAAATCATTCAGTTCCAAGAACAAATAAAGAGGGAAAGGACAGAGTTGGCAAACAAGCAATTACTGGAACAGAGATCATTGAAAGAACAACTAGAGGTTCATATACAGACAATTGGAATTTTAGTTGGAGAGAAACAAGAACTGCAAAGCACTGTTTCTCAGCTTCAAAGAAAATATGATATCAAGCAGAGTGAAAATACTGAGTTGACAAGCAGATTACAAACTGTTCGTCAAAAGGCTGGGGAACTGGAAAAAAACCTGGCTAATGTAACAGCTAGCTGTGAAAAATATGAAGATGATTCAAAGCGGTTTCGACAAGAGCGCGATAAATACCAGACAGCAATTTACACTCAAAATCAGGAAAAGGAAGAACTTGTACAACAGAATGAGGAGCTGAAAGTGAAGCTACAAACCAAGCTTGCTGAATGTGAACAGCTGAATAAGAATGAATCAGAATTGTCCTTCAAGCTGAAACAGGCTGAGCTTGTTGTACAACAGCTTTCAGGTGAACCAAGTTCTTCAGAGATTAATAATTTAGTACAGCAATTACAATCTGAGAAAATTGATCTTGAAAGTAAACTGGAACAGGTCAATACCACAATGCAAAGACTGGCAGCTGATAAAGGAGACCTTTTACGACAACATGCTGATGAAGTTGACCAATATGAAAGAAGAATACGTTTCTTGACAGAAGAAGTGGAGACTCATGGCAAAGAAAAGAATGCTCTGATCTTGAAAGAGTCTGAACTTCAAGACAGCTTACAGAGGGTACAGAAGGAGCTGGTTGATTTACAAGAAAAAGAAGCCACTCAACAAGTTGAATCAACTCAACTTGCTGCAGCTGAGATCGAACGATTGGCAGAAGATAAACAGCGACTAGCAGAACACTTGCAAAACGAGGGAAAAGAAAATGACAGACTTGTAAGGGAACAGGAAAGGTATCTGCAGAGAATTCAAGAGCTAGAGTCTGCTCTTGCTCGTATGGGTGAGGAGGCTATTGACAAAGCCACACTACTGGAGACCGCACAGAGCGATAAGGAGACTATCAGTAGAGCGTTAAAACAGAACAAAGATTTAAAGGAAAAAATGGAGCAGCTGGAAGAGAGATTTGTCACCATGAGTCACGAAAACATGACTTTAACCAGCAGTTTGGAAACAGAGCGTCACATGGCAAAAGAGCTTGCCTTAAAACTCAGTGATATGGGAGTGGAACTTGAAGAGTCCAAAGAACTACTCTTGTCAAAAACTTCTGAAATCCAGTCGCTGAGAGAAGAACTGGATCTAACCTCAGAGAAACTACAAGAAGAGGTTTCAAAGGAAGAGAACATGACTTCTTCCCTTAGGGAGGAGTTGGATATCTCTTCACAGCAGTTGCTAGAGCAGTTGAGGCATAAAGATTTCGAGATCTCTGCCATTCGTGAGGAACTGGAGTTATCCTCTCAGGAACTCACCGAGCAGCTTGCCAAGAAGAACATGGATTTGGCTTCCCTTAAGAATGAGCTCAGCCAATCAGAGGCAAGACTTACTGAACAGTTCTTACTGAATGAAAAGAACGCGGAGGCAACGAATCAGTCTGAAAGAACCAGCAATCTTCAATACCAGCTGGGGGTAGCACAGAATACCATCAACCAGTTAACGGCGCAAAACGCTGAGCTACAGGAAATGCTAAGAAACGTGGAGAACGGCGGCAGTATGGAACCATCAGGAACAGAGAGTTCAGACGAAGAACAAGCATCCAAACGCCCCGTTAATGGACCACAGGTACAACATGCTCACAATGGTACAACGGACAGTGAAGACGGCGAGATTCAACTCAAGCGACTGGCACCAGATGTTATTCCAGTACAAGCTTCAGAGCACATAGTAGGGGAGACACCTCCCTACATGAATGGAACCTTCAGTGAGGGGGAGAGTCTGTCCGGAACCGACTCCGGCGAAGAGATGAGTGCGTCACCATACAGGCCACTACACCCTCCCCCTCAGTCCAAATACACTGATAGGGGGGATGTGGTCGATTCACTGTCTGCGTCTATCCGGCAACTGGAGATGGAACGCGACCAGTTAGCGAGCATTTTGCACAGAACACAAGACGAGAGGGAAGACGATTATCACAGATTAAAACAACACATGGAGCTGCAACTAAATCAGCAACTGCAGCAACAGTACAGACTGGTACAGGAACAATGCCAACAGCATATCCATGAACAACAGCAAAAGATTCAGCTGCTTCAAGCTGTGATAGAAAAACAGAAGTTGCAGATAGAAAGGAAAGAGGAGCCTGAACTGCCCAACGTACCACTGGAACAGATGGAACAAGATGACATGTCACACGAAGCCATGAAGATGGCTTTCAGCAAATTACAGGCGCGCTTCATGAAGCTAATGAACGAAAAGGCGTCCTTGATAGAAAGAATTCAGGAACTGGAACACATAACAGTACAACTGTCAATGGAAACAGAAACCATTGGCGAGTATATAACACTTTACCAAACACAAAGGACTGCGCTCAAGTCTTACTACAAAGACAGAGAAAAATTGATCGCCCAATTGTCGAGTGAGAAAGCTAACATGCAGGAAAAAATGAACCAACTTCAAGATTTGATTAAACGAGTGCTTGAAGAGCGAAGCGAGCTCAGAATACAACAGCATCAGCTGCAAAGCGCAATAAACAGCAGATTGGTCGAACACGACCATCAGTCGCCCATTTCGTCTTTCCAAGATGGCGACGAAATCATCGAAGCTCAGGAACAAACTGAGCTCTCGAGCGATTTAAATGGACAAAATACAATGGACAACAGTGAGGTATCGAGCAGTTCGATTCCCGAGGAAACAGGAACAGAACTCAGTCAAATTGACGAAAACGATGAGTTGGATCGAAACGAGGGAACCGCTCGTCAAATCTTACAGATTCTTGAACAGTTGAGTCCTTCTGAAGAAGGAACTTACAAGGGATGGATGTCGCCCGATGTGCGCCATAGAGAGTTCTTGCCATGTCGGTACTGTGATGGACGCGTGCTGAGATTGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A1IH00	Golgin subfamily A member 2 OS=Danio rerio OX=7955 GN=golga2 PE=2 SV=1
Q08379	Golgin subfamily A member 2 OS=Homo sapiens OX=9606 GN=GOLGA2 PE=1 SV=3
Q921M4	Golgin subfamily A member 2 OS=Mus musculus OX=10090 GN=Golga2 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003970 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15070 all species →	GOLGA2L5	Putative golgin subfamily A member 2-like protein 5	Coiled-coil	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR024858 all species →	Family	Golgin subfamily A	Interproscan
IPR043976 all species →	Domain	Golgin subfamily A, conserved domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10881 all species →	GOLGIN SUBFAMILY A MEMBER-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000137 all species →	Cellular Component	Golgi cis cisterna	Interproscan
GO:0005794 all species →	Cellular Component	Golgi apparatus	Interproscan
GO:0005801 all species →	Cellular Component	cis-Golgi network	Interproscan
GO:0007030 all species →	Biological Process	Golgi organization	Interproscan
GO:0032580 all species →	Cellular Component	Golgi cisterna membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20358	GOLGA2; golgin subfamily A member 2	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074621077.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

77TPM > 0

2Conditions

63.2Max TPM

34.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	42	32.71	63.15
all_coral_tissue · baseline	38	35	37.60	58.17

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.15
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.61
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.76
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.14
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.81
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.28
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.12
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.03
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.09
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.65
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.48
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.76
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.23
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.82
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.86
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.89
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.34
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.78
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.24
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.42
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.59
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.22
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.83
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.97
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.14
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.26
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.60
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.89
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.13
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.79
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.70
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.30
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.92
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.63
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.79
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.45
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.43
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.69
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.87
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.48
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.49
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.17
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.96
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.31
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.07
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.57
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.68
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.28
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.44
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.26
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.77
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.38
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.03
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.95
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.58
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.46
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.97
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.01
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.91
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.85
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.44
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.46
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.25
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.65
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.96
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.25
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.51
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.24
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.05
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.57
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.52
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.46
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.22
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.69
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.38
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.33
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.