Gene detail

Detailed information of XP_074621263.1 in Acropora palmata

Genomic Location: NC_133885.1:21847802...21869435
NR annotation: XP_029203751.2, LOW QUALITY PROTEIN: sodium channel and clathrin linker 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074621263.1

ATGAGTTACGGTCAGCGAGATGAAGATTACTTCAAATTTCTACAAGATCAAGTTAAGAGGCTTAATGCTGTGGTTGAGGAGTACCAGAGGAAGTATCTCCCTGTTAAAGAACCAGACATAAAGACTGATGAACCTCTTCCACCATGGATGACAAACTCAAGTATTCTATCCCCTCTGTTGATGGAATATGATAACAACATCAAAGCATACCAGGAACAAGTGTTTTTCTTGAAGGGTGAATTGTCATCCCTTAAAGAGAAAACAGACCATGTTGTTCAAGAAAATACGAGACTTCATGAGGACTTGAGAAGGAACATTGAAACACAAATGGACTTAGTACGGCAAGGTGAAGGAAGTGGTGTGGAGAGAGTAGTCATGGAAAACATGCGCCATCAGCTTCAGATATTGTCTCAGGAACGGGACAACTACGTGGAACTTTGGCAAAATGCCACCCATGAATTGGAAAGCCTTCAAGAAATTGAGAGGGAAAAGGAGGTGGATCTCAAAACTAGGTCAAAGAATTTGACAAGCATGCAGAATGACCTGAAAAAGGCAAGACAGTTTGCAGAGGAGTTACAATTAGTGAATAATAAATTGAGGATGGAACATGAAAAGTTTCTTTCTACAGCGCAGACGCAAGACCAAGAGATTGATGAAGTGCGAAGCGAATTGAGGAAATGTAAGATTGAGTTGAAAAGCGTCAAAGCTCAAAATGACGAACTTCGAAGTACGCTAGAATTAATGGAAGGCAGGATTAGAGCGAGGGACAGAGAAAGAGGAGATGAATCCAACAGAGAACAAGAGGCCATTGATACTCGGGTCGAAGAGTTACACACAGCCGTCATTGAAATGGAGTCGAGGCTTTCAGCAGCTCTGAAACAAGTTGGGCGGCTTCGCACAGAAAAAACTGATTTGGAAGAAGCAGTAGGAATACTGCAGAAGAAAAGTTCTCAGCTTGAACAGCGTGAGTTTGAGGCCATCTCACACGTACGAGATAGTGTTCAGATGGTTGAAAATGCGATCCTTGAGAGAGACCAGGCTCTTGTCCGCGAACAACAGAAAGCCCAAGAGATTAACAGGCTTCAAGATGTGATCAATAAGATTCTGAAAGAAGCTGGCAAGAGGACCAGGGAAGAGGTTGATACTGTACGAAAGCAGTGCAATAATAACATTGAAAAACTTATGGAAGAGTTGCACTTCCTGGAAATGCAAGGAGCAGAGAAGCAAGCTCAACTGGAAAGATCACTCCGAGAAAAGTCTGCTGTAGAAAAAGAGCTTGAGAAGCTCTATCAGGAAGGTCCGACAGAGATTACAAGAGCGGGAATGACTTTTGATGAGTTGCAGAAGCGGGCGGGGCAAGCCGAGAGAACACGTGACGAAGCTTTGCGAAAAGTCGACACTCTAAATTCTACGATCAGGAAATTAGAAAACAAACACGAAATAGAAAAATCTCATGGCGCAACACAAAACAGCGATCTGAAAAGAAGGTTGAAAGAGTTGGAGGAAGAAAACGTGCAAATGTCTGATAGCAGAATCCAGTTGATTGGTGAAATTGACAAACTAAAACGCGAACTTCTGTCTGCCAAGCAAGTGAAGGAACAGGCCCAACACCAGTGCGTTACAGAGGTGGATAGTCTCAAACAGCAGCACGAGGTGCGAGAAAGGGAGTTTGAAACGCGTCTCCGCGGCGTTGAGGAAATGAATAGGCGATCAGTAAATGAACTCAGAGAAATGCTAACGGCGCAGCAAAAACTCGGCGCTCAGTGGAAAGAAGAATCGCAGGCGGTGACGCACAAGTTTGAGCAAACGGTGAACGAGTTGAGGCAGCAAATCGATAACCAGAAAAAACGAAACAATGAGCTGAACAGTCAACTTGATGACGAAAAGCGAACAACGCAACAACTTGAGTCTAAGCTTTCCGCGGCCAAGAAATCTGAAGGAAAACTTCAAAATATGGTGGTCGATGCTGAGACAAGAGCAGACGCTGCGAGCTCACAGGTGACAACACTTTTGAATCGCGAGAAGCAGCTTCTAGAGGAGAGAAACCTCTTAAATCGAGAGTTCGAGCGGCTTAAAATACGAAAGAGTCGGCCTGGCTACAGCAGAATCCGAGAACCGCCCGAGCGACTCTCCGACCTGCTGACCTCGACGATCGTCGGATCAACTGCACACGAGCCCGCGGTTCGTTTGGACTTGATGTCTCCTAGAAACGAGGAGCGCTTCACCAGAGACCTCAATGCAACAAGCTCACGAACATTGTTAAATGCGATTTCAAAAGACAGAGCTATTCTTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96NL6	Sodium channel and clathrin linker 1 OS=Homo sapiens OX=9606 GN=SCLT1 PE=1 SV=2
Q80UF4	Serologically defined colon cancer antigen 8 homolog OS=Mus musculus OX=10090 GN=Sdccag8 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003174 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15964 all species →	CCCAP	Centrosomal colon cancer autoantigen protein family	Coiled-coil	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR031887 all species →	Family	Serologically defined colon cancer antigen 8	Interproscan
IPR038911 all species →	Family	Sodium channel and clathrin linker 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR35970 all species →	SODIUM CHANNEL AND CLATHRIN LINKER 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0007098 all species →	Biological Process	centrosome cycle	Interproscan
GO:0005814 all species →	Cellular Component	centriole	Interproscan
GO:0045162 all species →	Biological Process	clustering of voltage-gated sodium channels	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25400	SCLT1; sodium channel and clathrin linker 1	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074621263.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

78TPM > 0

2Conditions

35.0Max TPM

19.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	43	17.82	34.99
all_coral_tissue · baseline	38	35	20.32	33.17

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.99
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.20
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.07
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.79
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.72
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.70
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.62
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.57
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.18
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.11
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.33
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.03
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.51
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.99
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.73
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.65
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.54
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.68
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.12
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.95
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.58
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.38
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.96
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.62
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.32
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.20
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.81
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.63
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.30
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.26
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.74
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.71
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.67
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.41
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.18
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.10
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.97
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.53
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.44
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.02
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.55
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.24
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.52
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.17
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.08
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.09
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.04
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.11
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.97
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.24
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.61
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.10
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.97
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.96
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.66
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.31
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.09
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.92
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.61
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.40
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.25
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.23
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.05
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.93
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.90
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.34
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.75
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.34
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.64
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.52
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.47
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.34
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.45
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.33
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.97
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.66
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.50
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.36
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.