Gene detail

Detailed information of XP_074621998.1 in Acropora palmata

Genomic Location: NC_133886.1:6966118...6997148
NR annotation: XP_029200686.2, GATOR complex protein MIOS-A-like isoform X3 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074621998.1

ATGAGCACATCAAAGTGGCAGGTCTTATGGTCTCCGTGCCACCTCGACAGGTTTATCACTTTTGGTAACGAGATTTGCCTTTACCAAGTCACCAAATCACAGGAAACTCAACCGAGAGTTCCCGGCATAAAGAGCCAAGTTATTGAACTCTCTGATGAAACATGTGCCTCACTTGTGTCTGTTCTGACAGAGATACAATATCTGAAGTGTGTGGCTTGGTATCCAGGACCTTTTCCGGAGAACTTGTTGGCTGTTGGGCAGGCAAATGGAAAAGTTCTGCTAACATGCATTGGCGAGGACAATTCACCAAACTTTGGTGCTGCAAGAGAATTTGTTCCTAAACATTCAAGGCAATGTAACAGCGTTGCTTGGAATCCAGTGGAGACTAATTTGCTTGCAGCAGGATTAGACAAAGCCAGGAATGACGCTTCTCTACTTGTGTGGGACATAAATGTCCAACTCAGTGTGAGAGACAGTGGAAGTCAAGAGAGAAGACATTCTGGAGTGCTTGGAGGAAGACAGTCACCTGTCACAGTTGGAGCAGGTTTCCCAATTGATCCATCAACAACAGGAAACAGACCAGTTGCTGAACTTTCTACCTCTGACCCTATTCTCTCTATGGCGTGGTCTTATGACCACAATATGTTGATCTGTGGACAGGGGCAAAAGTTTCTTAGAATCTTTGATATCAGAGACACAACGCGTCCTTTCAATGCAACTGTCACCAAAGCTGTGAGTGGGGTTTGCGTGGATCCTCACGTTGAACACAGAATTGCTTCCTTTTTAGAGGCACCTGGTGTTATATGTATGTGGGATGACAGGAACTTAGAGAAACCTTTAATGACCATTGGGCTGCCCTTTCCTTTGACGGCCATTTCATGGAGCCCAATGCGGTCAGGCTTATTAGCAGCCATTCGCAAAGAATCTGGAATTCTACAGCTGTATGACATTCAGCATGCCCCTGTAGTCCCCCCAGTTTATGGTATAGAAACGGAGCCATTCTGGATAGAGAGAAGTGTGCAAACTTCACAGTCAGCTCTTTCCTCCTTTACGTGGCACCCAACTCAGGAAAATCATTTGCTGACGATATCTCCTTCAGGTCACATACAGGATTGTACAATATTTGAAAGAATATCAGTAGCTTGGTCTCCTAGCTCTCATTTAACTTGGGGCTGTGGAAAGCATTTACTGGAATGCTCTCAAAAGCCAGCAGAGACTGAATTGGAAGAGGACATCTGTTTAAAAATGAAAAGAAGGGCTTTAGCTGGATATGGCATCAAACATCAACAGGTTGAAGACATAGAGAGAATAACAGGAGATCCAAAGCTTGTGAAGCTTTGGAAATGGATTTCTCGTTTCAAATCTTTGAGAGAGCAAGATAAATCAAAAAGTCTAAAATATGATGGCATCAAGTCCATAATAAGTGGAGAAAACAGTGCTGGAGCAGGAGTTCTCTGTACAAGGAGCACATATCAAGAGCAGTGTCTTGTTGCCCCTGTATATTTTAGTGATGAGAGGAAAATGGCCCTTTCTCTCTGTGGGTGGGACTTCAAAAGAGATGGATTACCATTGGCAGAATTCCTTAAAGAGCTTGAGGGTTGTGGCCAGTTTGAAAGAGCAGCAGCTGTAGGTCTTTTCAACAACAAAATCCAAGAAGCAATAAACATACTCAGCTCAAAAAGAACAAATGATAACCTTGGCGAGAAAGGTGCTACTCTCAACGTGGTTGCTATGGCTTTGTCAGGATTCACAGAGGAAAAGAAGACCACATGGAAAAAGATGTGTGGCTCTCTCTCCAGACAAATGGAAAGTCCTTATTTGAGATCGGCATTTGCTTTTCTGACCTCAGAGGGTGATAACTTTGACAGCATCTTAGCAGAGGAAGGAATGGAAATAGAAGATAGAGTTGCTTTTGCCTGTAAATATCTTCCTGATAGCAAGCTGTCCCAGTTTCTTGAAAGCTTGACTTCAAAGTTAACCAATGAAGGGGATTTAGATGGAATTCTCTTAACAGGTATATCATTGGATGGAATTAATTTGTTAGAAAAATATGTCAACAAGACAACAGATGTCCAGACAGCAAGTTTGGTCATTGTTAATTGTGTGCCTCATATATCAAGTGAAGTCTCCAAAGATGTGCGAGTCACATCGTGGATTGAAAATTATAGGAATTTATTGGATATGTGGAGACTTTGGCACCAGAGAGCTTTGTTTGATATTCATCACAATTTGAAGGATCCCAACCACAAACCTCCACGGCAAGTGACTGTGACTTGTAACTTTTGTCCCAACTCCATTCTCACCAATGTCCAGTCAACAGTATCAAGAGTCAAAAGGTATGCTCAGTACTCAAATCCCTCAAACAGAACAAAGATAATGGCCTGTCCTAGTTGCCGCAAACCTCTTCCCAGATGTTCCCTCTGTCTTGTTCACATGGGAACACCTTCATCTCTTCCACCAGAGCAGCAAATCCAAGATCCAAATGCAGAGAAGCCAGAAAATGTACGCAGTGTCAATCCATTTAAAACTTGGCTCACATGGTGTCAGTCGTGTCGTCATGGAGAGCACATGCTGAATGCCCTGTTACAGGATGTGGTTGCCACTGTATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8VE19	GATOR2 complex protein MIOS OS=Mus musculus OX=10090 GN=Mios PE=1 SV=2
Q9NXC5	GATOR2 complex protein MIOS OS=Homo sapiens OX=9606 GN=MIOS PE=1 SV=2
A4QNS7	GATOR2 complex protein MIOS-B OS=Xenopus laevis OX=8355 GN=mios-b PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002871 (this species only)
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17034 all species →	zinc_ribbon_16	Zinc-ribbon like family	Family	Interproscan
PF21719 all species →	MIOS_a-sol	MIOS, alpha-solenoid	Repeat	Interproscan
PF21720 all species →	MIOS_WD40	MIOS, WD40 repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR031488 all species →	Domain	GATOR2 complex protein MIO, zinc-ribbon like domain	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR037593 all species →	Family	MIOS/Sea4	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR049092 all species →	Domain	MIOS-like, alpha-solenoid domain	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16453 all species →	WD40 DOMAIN-CONTAINING PROTEIN MIO FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0034198 all species →	Biological Process	cellular response to amino acid starvation	Interproscan
GO:1904263 all species →	Biological Process	positive regulation of TORC1 signaling	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20407	MIOS, MIO, SEA4; SEA/GATOR complex protein SEA4/MIOS	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074621998.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

63TPM > 0

2Conditions

41.5Max TPM

13.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	34	11.37	41.51
all_coral_tissue · baseline	38	29	16.35	32.79

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.51
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.80
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.84
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.68
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.74
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.70
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.47
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.15
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.60
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.54
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.25
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.77
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.61
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.87
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.69
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.42
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.80
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.37
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.76
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.56
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.51
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.13
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.36
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.45
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.74
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.89
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.42
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.97
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.89
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.68
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.43
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.25
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.41
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.78
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.79
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.69
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.44
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.10
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.15
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.12
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.35
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.23
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.02
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.33
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.12
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.09
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.62
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.67
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.52
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.80
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.47
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.13
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.56
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.38
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.66
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.05
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.85
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.65
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.40
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.57
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.23
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.85
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.38
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.