Gene detail

Detailed information of XP_074622012.1 in Acropora palmata

Genomic Location: NC_133886.1:19805161...19838819
NR annotation: XP_029198424.2, integrin alpha-6-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074622012.1

ATGTTTCTTGTGCTAGTGACTCTGAGCTGCATCATTCGGCATTCCTGTAGCTACAATCTTGAGACCGAATCACCGATCATCAGGAAGGGAGACAAGGGCAGTTACTTTGGATTCTCAGTGGCCACTCACTCATTCTTTGACGATGCAGAGTCTCTGGCTACTCCCTCGAAGAATTATACCTGGCTATTAGTTGGAGCGCCGAAAGGCAACAGATCGATGCTACAAAGCCAGGGATTTTATAATCCAGGCGTTGTTATGCGATGCGATTTCAAAAATGACATCGACTGTTCAGCACTTCCGTTTCAGACGCGAGCGAGAGAAACTGACCCAAGCAAGGTTGAATTTAGCAATGGATGGTTTGGGGTGTCTGTGCTCAGTGCTGGACACAACGATGCTGTGTGGGCTTGCTCCCATAGATTACTTGTCCAATCAGGGAACTTCTACACTTATCCTGGACGATGCTATAGATCCGAAGAATTAGCCTCATCAGAAGATCCATCCAACTTTGCCGTGGAAAAACTTGACTACTGTGAAACACAAAATGCAAACAAGCTTTCTGGAGGAGGTCGGGAGACAATCAGTTATAAAGGTCACAAATTTTGCCAAATGGGAGTTAGTATTTCATTTGCAAAGGAACTTGGCAAACGTGACACTTCCCTCTTAATAGGAGCGCCTGGGGTATTTAATTATGAAGGACAAGTCATTTACTATGAAAAGTTCAAGACCTTAGATGTTTTGAAAAAGGACGGCAATCCCCTGGGATATCAAGGCTACTCTGTGACCACTGGGCATTTTTTCAAAAAGGATAAAAACGATGTTGCTTCTGGAGCGCCGAGACTTAATATTTCTGGCATGGTGATTCTGTTTAGAAGTTTACAGCCCGGAAAATTTCATGGTGATCCCATAGTCATTAAACCGCCTGCAGTAAACAAAGATGGTATGGCGGAATGGCGGCAGCCAGGGACTGGGTTCGGCTATGCAGTCTGTGGTGTCGATCTCAACAACGACGGGTTTTCCGAGTTGCTGGTAGGAGCGCCATTTTTCTCTGACGACTTGAATCCCGAAAAGGGACGAGTTTATGTGTACGAGAACAACGGAAATGGAAATCTGAGTTTGTCGCTGGAACTTCCAATCACCGCTAGCAAGAACATGTGGAGAGCTAACTTTGGACGTGCAATTTCTGCTGTGGGAGATATTGATTTGGACGGCTTCCAAGATGTGGCCATTGCTGCACCATACGAAGATCATGGCGAAGGTGCAGTGTATATTTACCGTGGATCTTCTAACGGGCTTGTTAAGACTCCCATGCAGGTTATCAAAGGCTCTAGCGTATCTCCTGGAATCAGAACATTTGGATATTCGCTTTCTGGAAGGCTTGACATGGACGAGAACGGATATCCTGATATTCTTGTGGGTGCTTACCAGTCAGATACTGTGGCCCTGATAAGATCTAAACCTGTTCTGTCAGTATCTTCATCGATTGCGGTTTCACCGAGCACGTTTGACATAGAGGGACGTAAGACCTGCAACGAAACTGGTCAAGGAAATGTTCAATTTGCCACAAAATGCTTTTCGATCAATGTTTGCGCAAGTTATACCGATAGAGCAGGAAAAATGAAAGATAAAGTTGCAATTGTCTTCACTTTGGAGTCGGACGTTGACTATGCCGAAAAAGATAAACGCGTTTTGTTCAGTATGAATAACCAGGAAAAGATTAATAACACAGTAGATGTTCAGACCTCTGAGGGTTGCTTCACATGGAAGGCGTACCTCAGGGAAAAAGTCGAGGACGTCTTTCCGGACATAAAATTCAGGCTCACGTATAAAATCGAGGAAAAAACTCCTCCTCCCCTAAAAGGTCCCACAGATGTACCTTCTCTTGTACGTTACGCTGTTTTGGATCCGACGGAGTCCAAAGAAGGCACTACCTTGGTGACTTTCAAGAGAGACTGTCAAAAGTGTGTTCCAGATTTAGTGCTGGATGATAGTAAAAGCAAAAAGACACTTGCTGTTGGAGCTGAGCTTTATACATTGGAACTCAGTGTCAAGAATAAAGGCGACGACGCCTACAATGCCAAATTGAAAGTTACGATTCCCAAAGATATCACGATTCGAAATATTTTTAAGCTTGTGGACAGCAAGAGAGATAAAATACCGAAATCTGACATTGAGGAAACTAAACTTAACACGAATGACACCACAGTAGCGATTAAGATTGGGAATCCAGTGAAAAACTATCAGAAAGAGCTCGCGAAGACAATTTTGGTTGAGCTGGATACTTCGCAGTACAGCGATGAGCCAGATTTCCTGCCTATTAACATGTCTACAGACAGCATAAATCGAGAGGAAGAAGCTACTTTAGATGACAACCATCGCTTCTTGAATATATCCATCAAGTCACAAGCTGATCTGGAAATAAATGGTACCACGGAGGAGGAACAAGTATCATATGGAGGAAAGGTCGTCGGAGAGAGCGCGATGAAACGAGTGGAGGACATTGGAAATGAAGTTATACATAAATATTTTGTGAAAAATCGTGGCCCAGATCAAGTTCCTTTAACTGAAATAGAGATTCAATGGCCTTATGAAGCACCTAGTGGAAAACATTTACTTTATCTCATAGATGTTAAGTCCGATAGCAAGGAAGTTGTTTGTGACAATGTACCTGGCCAGTTCAATATATTGGGATTGCAGACATCTTTATCACCCATCACCGGGCAACAGCTAAATGACACGGCTGTTACTACAGCGTACAAAACACGCCGAAGGCGAGAAGTAGATGACAAAAGTGCTGTAGGTAAACGAGAAGTGACAGACTCGAAAGGCAACCCTTCCACGCAACTGGATTGCGAAACGGGAACTGCGAAGTGTACAAACATCCGCTGCACCATTAAATTTCTAAAAGCAGGTGATGAAGTGACAATAAGAATCATTTCTCGGCTTTGGAATGGTACAATGATAGAGGATTATCAAGGTCAACTGGTGAATGTTGTATCGCACGCTTCAGTAAGACCGCTTAATTCTTATGTACTGGAGAAAAATAAAGAAAACAACGAAGCAGAGGTTGTAACTCAACTTAACCCAGATACCAACGTAGTGACTCCTCCCAGAGCTCTTCCAAAATGGGTCATTCCAGTATGTGTTGTTGGCGCTGTGCTGCTTTTAGTACTCATAGTGTTGTGTTTATACAAGCTTGGGTTTTTCAAGCGTCAAAAATATGACAAGAACATCACAAATTCAAAGGAAATGGAAGCCATGTTGGACAATGGATCGGTTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P26007	Integrin alpha-6 OS=Gallus gallus OX=9031 GN=ITGA6 PE=2 SV=1
Q61739	Integrin alpha-6 OS=Mus musculus OX=10090 GN=Itga6 PE=1 SV=3
P23229	Integrin alpha-6 OS=Homo sapiens OX=9606 GN=ITGA6 PE=1 SV=5

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000604 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20806 all species →	Integrin_A_Ig_3	Integrin alpha Ig-like domain 3	Domain	Interproscan
PF01839 all species →	FG-GAP	FG-GAP repeat	Repeat	Interproscan
PF08441 all species →	Integrin_A_Ig_1	Integrin alpha Ig-like domain 1	Domain	Interproscan
PF20805 all species →	Integrin_A_Ig_2	Integrin alpha Ig-like domain 2	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013519 all species →	Repeat	Integrin alpha beta-propellor	Interproscan
IPR000413 all species →	Family	Integrin alpha chain	Interproscan
IPR028994 all species →	Homologous_superfamily	Integrin alpha, N-terminal	Interproscan
IPR048286 all species →	Domain	Integrin alpha, third immunoglobulin-like domain	Interproscan
IPR013517 all species →	Repeat	FG-GAP repeat	Interproscan
IPR032695 all species →	Homologous_superfamily	Integrin domain superfamily	Interproscan
IPR018184 all species →	Conserved_site	Integrin alpha chain, C-terminal cytoplasmic region, conserved site	Interproscan
IPR013649 all species →	Domain	Integrin alpha, first immunoglubulin-like domain	Interproscan
IPR048285 all species →	Domain	Integrin alpha, second immunoglobulin-like domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23220 all species →	INTEGRIN ALPHA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007155 all species →	Biological Process	cell adhesion	Interproscan
GO:0008305 all species →	Cellular Component	integrin complex	Interproscan
GO:0005178 all species →	Molecular Function	integrin binding	Interproscan
GO:0007160 all species →	Biological Process	cell-matrix adhesion	Interproscan
GO:0007229 all species →	Biological Process	integrin-mediated signaling pathway	Interproscan
GO:0009897 all species →	Cellular Component	external side of plasma membrane	Interproscan
GO:0033627 all species →	Biological Process	cell adhesion mediated by integrin	Interproscan
GO:0098609 all species →	Biological Process	cell-cell adhesion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074622012.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074622012.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

71TPM > 0

2Conditions

110.1Max TPM

39.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	39	39.16	110.09
all_coral_tissue · baseline	38	32	39.09	84.01

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	110.09
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	88.45
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	71.27
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	68.39
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	67.79
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	66.86
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	66.41
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	66.20
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.63
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.24
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.85
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.06
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.04
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.88
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.52
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.98
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.85
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.47
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.69
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.92
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.02
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.42
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.66
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.54
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.26
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.39
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.37
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.75
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.96
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.79
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.42
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.34
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.29
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.67
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.10
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.29
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.95
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.31
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.09
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	84.01
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	72.02
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.46
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.92
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	65.70
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.33
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.34
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	60.12
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.13
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.63
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.45
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.11
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.25
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.95
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.20
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.43
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.41
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.35
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.49
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.14
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.01
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.70
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.04
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.55
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.01
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.41
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.21
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.64
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.57
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.45
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.26
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.09
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.