Gene detail

Detailed information of XP_074622014.1 in Acropora palmata

Genomic Location: NC_133886.1:19837930...19853612
NR annotation: XP_044179430.1, BRCA1-associated RING domain protein 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074622014.1

ATGTTAGGTTGGAGAAATACAAGGGATGCTTTATATATGCTAGAAAAGCTTCTGACGTGCAAAGTTTGTGACAACCTGGTATCCGACCCCTGTTCCCTGGAGGCGTGTGATCACATCTTCTGTCGTTTATGTATAGAAAAGCTGGTGGGAAGTGATTCCAAATGCCCGGAATGCGGAGCCTTTGCCTGGGTTAAGGACATGAAAACAAATCGTCAGCTTGCAAACACTGTCACAATGTGTCGCAAGATGAGAGTGCTGGTTGATAATAATGAGCAGAGTGATAATGGTGATGATGATACACTAATGAAGTGTCACACAGACAATGGCAGCACCAAAGCAATGTTTTGGGAAGAAACACAGCATGAAGTTGAAATGGGAGCTGATTCATATCAGTTCTCGTCACCAGTAGATACTACAACCTCTAATTCACTGAATAAGTGCGCTGCTGCTGTCAAAGAAGTATCACACAATCATAAGAGAACATTTAAGAAGCCGAAATGCAAGACCAAGATGCAAAAGGAGGAACAAATTGATGTAAAAGAGACACATGATCATACTAAGTTGAATGACAAGCAAGGAGAAACAAACCAGTTAGGAAAAGATGCTGCAAAGTTGCTATCATGCCAAAGTGGTAAGTCAGAGAGCAGTGAGGGTGCTACTCCAGAAAAAGGTAGTGCTTTGGGTTCAAGAAAATTATCCAAGAGGCTTCAAGTCATGCAAAAATGCTTTGGAAAAAAATCAAAACCCACCCAGGCAAGAGTAGGAAGGAAAGCGGCATCATTGGTAAATGAAGTTTTGAGCTGTGATGAGCTAGAAGCTGAGAATGAAGCACAGACTGATTGTGGAATTGCAGACAATACCAGCCATTTGCAGTTTGTGGAACAGAAACTGGATGAAGACAATTTGGAATTAGAAAAGGGAAATGGTGTTGAGGAATTCTACACAAGAGTCAAATTGAAAGATGATCAGTGTGAAAGGACCACTGACAGGAATGAAGATATTGAGAGCAATGGCAAAACTAGAGCACAGAAAAGGAAGCTGCGTCAAGTACAAATGCTGCTTTCGTTTGCTAGCAACCCTCAACAAGAGTCACAAGAATCCAGTGACACTGACAAGGGACTAAAGATCGATAATAGGAAGAGAGAAAACAAGAGTAACAACGACACACCAGTTAAGCAAGGGATTACCAGTAGGAAACCTCCAACTCAGAATTTCTGCAGCCCACAGAATTGGGCGTGTGGACCCTCTGCTGTTAAGAGAAACATACGAGGCGAGACACCGCTTCATGTTGCAGCCATCAAGGGCTGCGTTGAATCCGTCAGAAAAATTCTCACAGAGGGAGCTGATCCAAACACAAAGGACCATGCAGGATGGACTCCGTTGCATGAAGGGTGTAACCATGGCTACCTATCTATTGTTGAGCTGCTATTGGACTATGGTGCCATGATTGACACTCCAGGGGGGTTTGATCATGACACGCCCTTGCATGATGCCGTCTCCAATGGACGAATAGAGGTGGCGAAGCTGTTGATCAACAGCGGAGCTCCTTTGGACATCCGAAACAAACGAGGACTCGTGCCAATCGATTATGCAACAACGGATGAAATGCGAGCCATCTTGTCAGCATCAACTCTCAAAACGTGCAGTCAAGGGTCAACACAACTGCGGATTTTATCGCTACCAGAGAACGAAAAGTTTTCAAACGGAACTCCTAAAGTTCTCCTCGCGACTGGTCTTAGCTCTGAGCAAAAGGCAAATCTTCAAACCTGTGCACTCACTCTCGATGCAAAGATTGTCAGCGAATTCTCTCCTTCTGTTACCCACATTGTTACAACGACGAATGGGAAAGGAGTTTGCCCAAGGACTATCAAGTATTTAAATGGCGTTCTGACCGGAAAATGGATCGTTAACTATGACTGGATAGTAAAATGTCTGCGACAGAAAACGTGGATGGATGAGCGTCCGTATGAAGTTAAAGGAACAAACGATGCTTCTGTTGATGCTCCAAAAAGAGCGCGCATCAATGCTGTCAAACAGCTTCCCAGTCTGTTTGACGGTTGTCAGTTTTTCTTTTACGGGGATTTTTTCCCACCCCACCCTGCTAAGGAAGACCTCGTCCAGATGATCAAGTATGGCGGCGGAAAGATTCTGTCACGTGAGCCTAAACCACGTGTTGACGAAACGCTCTGTTTACCAAATAAGGTGCCTGTGCAAGCTGTTTATTTAGCTCCTGTGGCATACCATGCGAATCCCGAGTCGGAGCTCTACCGTTGCACTCAGTACATCATTTATAATTCGCTCTACGAAAAAAAGCCGCACATCTGGGAAACCATGACGCTTCGCACTTTACCTTCGACCTGGCTCATGGACTGTGCTTCGAATTTTGCGATTCTTGATCCAGAGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O70445	BRCA1-associated RING domain protein 1 OS=Mus musculus OX=10090 GN=Bard1 PE=2 SV=1
Q9QZH2	BRCA1-associated RING domain protein 1 OS=Rattus norvegicus OX=10116 GN=Bard1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005885 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14835 all species →	zf-RING_6	zf-RING of BARD1-type protein	Domain	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF00533 all species →	BRCT	BRCA1 C Terminus (BRCT) domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036420 all species →	Homologous_superfamily	BRCT domain superfamily	Interproscan
IPR017907 all species →	Conserved_site	Zinc finger, RING-type, conserved site	Interproscan
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR039503 all species →	Domain	BARD1, Zinc finger, RING-type	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR001357 all species →	Domain	BRCT domain	Interproscan
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24171 all species →	ANKYRIN REPEAT DOMAIN-CONTAINING PROTEIN 39-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0031436 all species →	Cellular Component	BRCA1-BARD1 complex	Interproscan
GO:0070531 all species →	Cellular Component	BRCA1-A complex	Interproscan
GO:0085020 all species →	Biological Process	protein K6-linked ubiquitination	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10683	BARD1; BRCA1-associated RING domain protein 1	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074622014.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

43TPM > 0

2Conditions

14.9Max TPM

1.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	23	1.80	14.93
all_coral_tissue · baseline	38	20	1.81	7.66

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.93
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.46
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.76
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.28
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.12
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.55
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.47
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.27
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.02
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.97
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.84
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.82
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.82
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.82
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.80
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.51
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.49
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.43
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.43
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.97
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.97
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.95
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.66
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.67
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.03
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.28
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.82
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.62
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.39
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.37
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.20
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.17
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.07
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.03
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.87
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.79
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.75
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.62
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.40
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.39
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.23
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.57
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.