Gene detail

Detailed information of XP_074622239.1 in Acropora palmata

Genomic Location: NC_133886.1:7252372...7279080
NR annotation: XP_044178745.1, semaphorin-5A-like isoform X3 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074622239.1

ATGACAAACAGTATAACCAAGATGAAGTTGATGTTATTGGCTCTTTGTGTCACGTTCATAACAAGCCAGGAAGAGTCCATTTCACCTTACGAAGAAATCAAGAAGTTTGTCAAAACCTTCAAGCCAAGAGGAATGAATGCCAGTACATATTATTTGCTTTCCATTGATGAAAAACACAACAACCTTATTGTTGGGGCAAGAAATAATGTGTTTTTGGTGAACTTGGGTGATATGGAAAGTTATGAGTATTGGAATGTACCACAACAGCCTGGCGATAACGCTTTTGTCAAGATGATGTTACCTTTTGGAGACAGAATTTTACTCTGTTGGGTTGAAAAGCCATCCACTGGAAGCTGCACTTGGAGAAATAGGACAACTTTAGATGAAGCTCCAGAAAGCAATCAAGGATATGAGTTCAAGTCAATTGAAACATACAATGCACCAAGTTCATCACCAGATCAGAATGATACAGCCATTATCACAGAGGACGGGACTCTCTTTGTTGGAACATTTTTGGCCCTTGGAGGCCATTCAATCATTTACAGCAAGAGGTTCAGACATCCCCAGCTGACGGAAGTTTTCTCTGCGAGACGGACTTCCTTTTATGAAGATGTGCATTTCGTAAAGAGCTTTGAAATTGGCCCTTACGTCTACTTCTTTTTCCGCGAACGATCGTTGGAATGCTCCAGTTGCGGAAAGGTTAAAACTTCCAGGGTAGCAAGAGTGTGCAAGGGCGATCGTGGTGGCAACCATCGGCTGTTAAATTATTTTGTAACCTTACAAAAGGCGAAGTTAATGTGCAGTGATGGGAAGAATTACGCGCTCAATTTTAATGAAATTCAGGATGTTTGGTGGGACAATCGCACAGGTCAATTTTATGCAGCTTTCAGCTCACAGCCGAATGGTCCTGCGATATCCGCTATTTGCATTTACAGCTTGTCATCAATCAATCGGATTTTCATCGAAAGTGATTTCAAATCTTTCACAAGTGAAACTAAGGGTTGGACCAAAAACAGGAATAAGATTGGAGAATACTTTCCAGGCTGTAAAGTGAATCCGAAATGCCTCAAAAGCTCTTATTCGGCCGTTGCTGATGGCGTGATGGCTACAAAACATATGCGGTCATCAGCTTACGTAGACCTAATGTATAATACGCTGATGGCTGATGGAGTGGAGCCACTTGGATCGAAAGCATGGTTTATTAGAGACGGGATCAGAATGACTGCCATTTCCCTGGACGTCGTTGGGCAGAATATCGTGGTGTACGCTTCAACAGATCGAGGGTCTGTTGTGAAAGTTGCACAACCGCAAGGGCTTTCTCAGCCATGTCTTTATTCTGAAATGGAAGTTTATCCTTCGAACAAGAAAGAGGTCATCAAGACCATGGTGGTTGATCAGGTTCGGCATGTTCTGTACTTGGGAACACGTTATTCGCTTACACAGCTAAGTTTGGATCAGTGTGCACGACATCAGCACGACAAGAGTGCTTGTATTTTGGCTGCTGATCCTTACTGCGTGTGGGACGACAAAACATTCCGTTGTTCTTCTGTTCTTTCGCATGGGGAGACTCCACAACAAAATTTGACAATCTGCCCAAAAGTCCGCAAAGAAACTAGCTGGTCTTCATGGAGAACCTGTGTTCAAAGGGACGGAAATCTTTGTCGTTGTCAAACACGTCGCTGTCAAGAAAAGGGAAATACACTCTGCCTGACTGATGTGGAGGTCCGATTGGAAAATTGTACAGTGGACTTGACTGTGGGCTGGGAGGGCGAACGCTCTTGGGAAATTTTAGGAGTGCAACATGGTAACTGGAGCGCGTGGGGGAACTGGAGCGAGTGCTCGACAGAAACCTGGGCAGGCGTAAGGAACAGGTCACGGACATGCACCAACCCACTCCCCAGGAGCGGTGGAAGGACCTGCGTTGGAGACTCGATTCAGTATGAGCCTTGCAGTCTGGAAATTCAGGAGGGCAAATGGAAGCCTTGGGGCAACTGGAGTGTATGTGCCGTGGAAGGCTTTCAGATAAGAAGAAGAAACTGTAGCAAAGAACGTTGTTTCGGAGAGCGATTACAGGAAAGAATTTGCACACCAACAAGTGAGCGCTGTGAAGGTGTCATTGATTGCGGCTGGGAAGTGTGGTCTTCCTGTTTTTGTGATCACGGGTTAAACTTGGCTAAAGAAGGTTCTGGTGTAATGTACAGGGTTCGCAAGTGCTGCAGGACGTGCCCAAACGAACCCTCTTGTGCCAATAGCGTTGAGTTCAAGATGTGTTTCTGTAAAAGAGAGACAAGTGTCTTGGGACAAGAACAGGGACCTCATCCATCCGACAACGTCATCGCTGGTCCCGTTATTGGTGTGATTGTGGGAAGCGTCGTAGTGATTGGCTTGTGTGTGGTTGTGATTTGTTACGTGAACCACAAAAAAAAAGATTTCGATGTTTCCAAGACCGAGAAAAACAACTCTCACGATGCTGGTAGTGAAAGCAAGTTTTCCACATTCCGATCAGCGACTGACGAATCGAGAAAGCCGTTGTCTCCTTCTGGCAGCCCTGGAAAACGTGACAAAAAGAAGAGCCCAAAAATCAAGTTGCCGATGAAGAATTTCCTCCCAAAGAGAATGAGAGAGACTCCTCGTTGTTCCGTAGCTTGCGTATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q13591	Semaphorin-5A OS=Homo sapiens OX=9606 GN=SEMA5A PE=1 SV=3
D3ZTD8	Semaphorin-5A OS=Rattus norvegicus OX=10116 GN=Sema5a PE=1 SV=1
Q62217	Semaphorin-5A OS=Mus musculus OX=10090 GN=Sema5a PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001596 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01437 all species →	PSI	Plexin repeat	Family	Interproscan
PF01403 all species →	Sema	Sema domain	Repeat	Interproscan
PF00090 all species →	TSP_1	Thrombospondin type 1 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036383 all species →	Homologous_superfamily	Thrombospondin type-1 (TSP1) repeat superfamily	Interproscan
IPR001627 all species →	Domain	Sema domain	Interproscan
IPR002165 all species →	Repeat	Plexin repeat	Interproscan
IPR016201 all species →	Domain	PSI domain	Interproscan
IPR000884 all species →	Repeat	Thrombospondin type-1 (TSP1) repeat	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR027231 all species →	Family	Semaphorin	Interproscan
IPR036352 all species →	Homologous_superfamily	Sema domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11036 all species →	SEMAPHORIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0001755 all species →	Biological Process	neural crest cell migration	Interproscan
GO:0030215 all species →	Molecular Function	semaphorin receptor binding	Interproscan
GO:0030335 all species →	Biological Process	positive regulation of cell migration	Interproscan
GO:0045499 all species →	Molecular Function	chemorepellent activity	Interproscan
GO:0048843 all species →	Biological Process	negative regulation of axon extension involved in axon guidance	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06841	SEMA5; semaphorin 5	-	Axon guidance	ko04360	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074622239.1 across 84 RNA-seq samples of Acropora palmata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

0TPM > 0

2Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	0	0.00	0.00
all_coral_tissue · baseline	38	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.