Gene detail

Detailed information of XP_074622601.1 in Acropora palmata

Genomic Location: NC_133886.1:12098661...12128608
NR annotation: XP_029189175.2, cytoplasmic dynein 2 intermediate chain 1-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074622601.1

ATGCCATCTAGCAAGGATCGTAGGGAAGACACATGGAAGGAATCTGATCTCAAAAAAGCATTGAAGCCTGATGACAAGAAAAACTCAAGAGATGATGGTCAAAAATCCAAGGAAAGGTCAAGCCGCAAGTCTGAGGATAAGAGAGAACGCAGGGAAGGTGATGATGGGATAAAACGAAGAAGACACCTTGATTTAGGCAATGGGGAAGAGCATTTGGATGGCAGAAGAACTCAAAAGGACCATGGTGTGGAGAGGGACAGGGACAGAGACAGGGACAGGGAACGAGACAAAGATCGAGAAAGAGAAAGGGGTAGGAGAAAAAGAGAGGAAAACAAGGACAAAGAAAGAACTAAAGAGAGAGAAATAAGGAAAGAGAAAGACTCGGAAAGATCAAAAGATACAAGAAGTACTTTGGAGAGGTCAAAAGAAAGGGAGAGAAGTAAAGATGGACTAAAAGAGAGGGAAAGTGGCAACATGGGACGTGATAAGGATAGAAGAAGAGACAGAGACATAGACTCGGAGAAACAGAAACACAAACTGTATAGTAGTGAAAAAACGGAGGGAACAAAGGAAAGGGAAAGGAGTAAAGAAAAGCACAGAGACAGGGACCGAAGTCAAGAGAGACTAGGAGATCAGGACAGAAGTAAAGAACAAAGGAAGGAGAAAAGAGAAAATAGGGAAGAAAGGAAAGATAGAGAGTTTGAGAGAAGTCGCGACAAAGAACATAGTAGGGAAAGAAGGAAACAACAGGAAGATAGAGACAGAAAATACAGAGATAAAGACAGGGACAAAGAAGTGGAAAAGGAAAGAAGAAGAGAAAGGGAAGAGAATAAGGAGCACCGCAAAGAAAGGGACAGGGATAACTTGGCATTACAAAATGAATATGCTGATGACAGAAGGAAGAGTGAACGACATGACAAGGACTTAGACAAAAGATCAAAGCGTGAGGAGAGCACAAGACAAAGGAGGCATCATGAGAAAAAAGATGACAGAAGAGAACAAAGAGATGACAAGGACAGGAGAAAGGAACAATTTGAGAAATATGATGAGAATGAAAAAGAAGGGAAGATAAAGAGAAGAGAAAAGGAGTTGATGGCTTCCCTGAAAAAAGAAGAGGAATTTAGGAAAGAGCACTTGAAATTAACCAAATCAGATACTCTTGAAGAGGCAGATGTTGTAGATGAAGATGTTGAACAGAATAAGAAGGTCCCATTACAAAGGATGCCATCAGAAGGTACAGCAGAAGAAGTCCATGAAGAGGAGAATGATGGCTACAACTACGAGGAGGATGACTTTGAGGATTATGATGAAGACTTTGAAGATGATGATGGTGATGATGATGATGATGATGATGATGATGATGATGATGATGGGGGTGAAGATTATGAGACCAGTCTAGATCTACAGGATAACTCAGGATTGCAAGAGCTTCTCCAAGCACTCAGTGCAGAGAATGAGGGAGCCAGAGCTTCATCAAGGGAAGAACAAACTGATGACCAAAGAGAAACTACTAAAGAAAAACGTCAGTCAAGGTCAACAACACATGGACGAATAAACTTTGTTGCTGCGAAACAGAAGCAGATTTCTGATAAAGTGGCCTCACGAACAAAAAAGAGAGGACAGGAGTTAATGCGCCTCATTGACCTTGATGTAGCTGTGTTTGACATTTTTGATTTGCCTCCGCTCAATGAGTATGAGCTGTATATTAAAAATTTTGGAAGATCTGACACTAAGCAGGCGTACGTGCAGTGCAATGAAGATAATGTTGAAAAAGAAGTACAAACAGAGGAAATAGAGACAATAACAAAATGGACACAAAACCCTGCAATTGATGCTGCAGGATTTGGAGATGATGAAGATGATTCGCAGGAAGATTTCTCCAGCTTAACAGAAAAGGCCAACATCGACAGCATAAGATTAGCAAGTTTTCTCCAACGAGCCACCCAGACATGTTTAATATTATTGGAAGAATGCGTCAGTAAACAGACGAACGCTCTATTCAAAGAAAAGAGAGAGATGACTTGCAGTGATGGCTTCCTGCAGCTATCAACCAAGCACTCGTATCTTGAAGGTCGGTCAGTACAATATGTTTACGTATCCCCTGTGCAATCCCACTTCTTGCTTATTGCTTATGCGCCGGTATCAGACAAGAACAAAGCAAGTTCAAAGACTCCCGACATGGTTCAAGATAAAGGCTTGGTGTGTGTCTGGAACACAAATGACCCGTTCAATCCTGAAAAACTGTTAATATGTGAATCTACCCCTCGGTGCTGTTGTTTGAGTCCATCCAAGGCAACTTTAGCATTTGCTGGTTTGGAGGATGGATCGATTGTTGCATGGGATTTGCGGGAGCCTTTATCCACTCATTACATGAACAAAGTGTGTGATGGAGACAATGAAGTCATTTTCAGGCCACCCACGTTTAGCACAGCTGGTGTCTTAAAAAAAGACGAAAGCCACTTGAGTCCAGTTGTATCTCTGTTGCCACTCGTTATGCCAGGAGACAGTGTCAGGGCCTCTATTGCATCAAACATGATGTCCGATGACATGTTAGGATTGTCTTTTCAATTAGCCTCCTTAGAAGAAAATGCCTCAGTTTATCTTTGGGTTGTGGTAGAGCTTGATAGAACAAATAGTGCAGGCTCAGAATCCGATCTAGGACTGTCTCCAGGAGGAAAAATCAAGCTCATTAAAAGTTCTTCAATCGCTGTGCAATCGCCCTTTAGGAACTTTCCAAACCGGAGTTGTTTGCAAGCACTCATTCTCAGATTCCTTCCTCATGATCCGAATCACGTTTATGTTGGCACAGACGGTGGTTATGTTGTTCATTGCGACAGACATGGCGGTCGAGCTTCACCGAAGGCCCACAGACCAGTAATAGACACCATAGAGCGAATAACAGCCATTGATTTGTCACCATGGCAGTTGCCTTGTATGCTATTAGGCAGTGAGACTGGCAATCTTTGGCTCTTTAACTTAAAAAATGAATTCCCACTGCTCAGTTGGCCATCAAGTACAAGCGGCAGTGCGATATTGTCCGTACGATGGTCTCACAGCAGACCCAGCGTGTTCTTCGTGTTGGATTCACAATCGAATCTACATGTCTGGGATTTACTTAAAAGTGACCAAGGCCCAATTACGGTGGAGAATTTCAAGCACAGCCGCGTAACGTGTTTTGAGCTGTCCAGCGATTATTCATCATCAGGAATTGGAATCCCAGGAAGGAACGCTGAACTGATATTGGTTTACGAAAGTGGAGCGGTGGAAATTCACAGAATAAGCAGTGTTTTCTCCAAGGCTTCTGGTGATGACATGGATCGATTTGCGAGCTATCTAGAGGGCGTGCGCCTTCAAGTTTCCATCAGCACCTCACTGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8WVS4	Cytoplasmic dynein 2 intermediate chain 1 OS=Homo sapiens OX=9606 GN=DYNC2I1 PE=1 SV=3
Q8C761	Cytoplasmic dynein 2 intermediate chain 1 OS=Mus musculus OX=10090 GN=Dync2i1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003649 (this species only)

Pfam domain

No Pfam domain signature was detected for XP_074622601.1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR042505 all species →	Family	Cytoplasmic dynein 2 intermediate chain 1	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16022 all species →	WD REPEAT DOMAIN 60	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005868 all species →	Cellular Component	cytoplasmic dynein complex	Interproscan
GO:0042073 all species →	Biological Process	intraciliary transport	Interproscan
GO:0045503 all species →	Molecular Function	dynein light chain binding	Interproscan
GO:0045504 all species →	Molecular Function	dynein heavy chain binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K22869	WDR60; WD repeat-containing protein 60	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074622601.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

56TPM > 0

2Conditions

20.4Max TPM

7.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	31	7.28	20.41
all_coral_tissue · baseline	38	25	7.24	16.29

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.41
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.06
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.96
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.65
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.59
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.41
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.67
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.29
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.05
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.75
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.61
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.21
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.45
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.34
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.84
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.36
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.84
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.02
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.35
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.74
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.70
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.24
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.98
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.62
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.39
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.80
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.70
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.44
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.27
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.75
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.58
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.29
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.48
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.90
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.90
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.14
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.89
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.88
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.82
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.80
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.54
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.90
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.70
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.68
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.37
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.04
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.95
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.42
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.26
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.74
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.58
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.51
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.72
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.94
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.58
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.02
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.