Gene detail

Detailed information of XP_074622602.1 in Acropora palmata

Genomic Location: NC_133886.1:12100302...12128608
NR annotation: XP_029189175.2, cytoplasmic dynein 2 intermediate chain 1-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074622602.1

ATGCCATCTAGCAAGGATCGTAGGGAAGACACATGGAAGGAATCTGATCTCAAAAAAGCATTGAAGCCTGATGACAAGAAAAACTCAAGAGATGATGGTCAAAAATCCAAGGAAAGGTCAAGCCGCAAGTCTGAGGATAAGAGAGAACGCAGGGAAGGTGATGATGGGATAAAACGAAGAAGACACCTTGATTTAGGCAATGGGGAAGAGCATTTGGATGGCAGAAGAACTCAAAAGGACCATGGTGTGGAGAGGGACAGGGACAGAGACAGGGACAGGGAACGAGACAAAGATCGAGAAAGAGAAAGGGGTAGGAGAAAAAGAGAGGAAAACAAGGACAAAGAAAGAACTAAAGAGAGAGAAATAAGGAAAGAGAAAGACTCGGAAAGATCAAAAGATACAAGAAGTACTTTGGAGAGGTCAAAAGAAAGGGAGAGAAGTAAAGATGGACTAAAAGAGAGGGAAAGTGGCAACATGGGACGTGATAAGGATAGAAGAAGAGACAGAGACATAGACTCGGAGAAACAGAAACACAAACTGTATAGTAGTGAAAAAACGGAGGGAACAAAGGAAAGGGAAAGGAGTAAAGAAAAGCACAGAGACAGGGACCGAAGTCAAGAGAGACTAGGAGATCAGGACAGAAGTAAAGAACAAAGGAAGGAGAAAAGAGAAAATAGGGAAGAAAGGAAAGATAGAGAGTTTGAGAGAAGTCGCGACAAAGAACATAGTAGGGAAAGAAGGAAACAACAGGAAGATAGAGACAGAAAATACAGAGATAAAGACAGGGACAAAGAAGTGGAAAAGGAAAGAAGAAGAGAAAGGGAAGAGAATAAGGAGCACCGCAAAGAAAGGGACAGGGATAACTTGGCATTACAAAATGAATATGCTGATGACAGAAGGAAGAGTGAACGACATGACAAGGACTTAGACAAAAGATCAAAGCGTGAGGAGAGCACAAGACAAAGGAGGCATCATGAGAAAAAAGATGACAGAAGAGAACAAAGAGATGACAAGGACAGGAGAAAGGAACAATTTGAGAAATATGATGAGAATGAAAAAGAAGGGAAGATAAAGAGAAGAGAAAAGGAGTTGATGGCTTCCCTGAAAAAAGAAGAGGAATTTAGGAAAGAGCACTTGAAATTAACCAAATCAGATACTCTTGAAGAGGCAGATGTTGTAGATGAAGATGTTGAACAGAATAAGAAGGTCCCATTACAAAGGATGCCATCAGAAGGTACAGCAGAAGAAGTCCATGAAGAGGAGAATGATGGCTACAACTACGAGGAGGATGACTTTGAGGATTATGATGAAGACTTTGAAGATGATGATGGTGATGATGATGATGATGATGATGATGATGATGATGATGATGGGGGTGAAGATTATGAGACCAGTCTAGATCTACAGGATAACTCAGGATTGCAAGAGCTTCTCCAAGCACTCAGTGCAGAGAATGAGGGAGCCAGAGCTTCATCAAGGGAAGAACAAACTGATGACCAAAGAGAAACTACTAAAGAAAAACGTCAGTCAAGGTCAACAACACATGGACGAATAAACTTTGTTGCTGCGAAACAGAAGCAGATTTCTGATAAAGTGGCCTCACGAACAAAAAAGAGAGGACAGGAGTTAATGCGCCTCATTGACCTTGATGTAGCTGTGTTTGACATTTTTGATTTGCCTCCGCTCAATGAGTATGAGCTGTATATTAAAAATTTTGGAAGATCTGACACTAAGCAGGCGTACGTGCAGTGCAATGAAGATAATGTTGAAAAAGAAGTACAAACAGAGGAAATAGAGACAATAACAAAATGGACACAAAACCCTGCAATTGATGCTGCAGGATTTGGAGATGATGAAGATGATTCGCAGGAAGATTTCTCCAGCTTAACAGAAAAGGCCAACATCGACAGCATAAGATTAGCAAGTTTTCTCCAACGAGCCACCCAGACATGTTTAATATTATTGGAAGAATGCGTCAGTAAACAGACGAACGCTCTATTCAAAGAAAAGAGAGAGATGACTTGCAGTGATGGCTTCCTGCAGCTATCAACCAAGCACTCGTATCTTGAAGGTCGGTCAGTACAATATGTTTACGTATCCCCTGTGCAATCCCACTTCTTGCTTATTGCTTATGCGCCGGTATCAGACAAGAACAAAGCAAGTTCAAAGACTCCCGACATGGTTCAAGATAAAGGCTTGGTGTGTGTCTGGAACACAAATGACCCGTTCAATCCTGAAAAACTGTTAATATGTGAATCTACCCCTCGGTGCTGTTGTTTGAGTCCATCCAAGGCAACTTTAGCATTTGCTGGTTTGGAGGATGGATCGATTGTTGCATGGGATTTGCGGGAGCCTTTATCCACTCATTACATGAACAAAGTGTGTGATGGAGACAATGAAGTCATTTTCAGGCCACCCACGTTTAGCACAGCTGGTGTCTTAAAAAAAGACGAAAGCCACTTGAGTCCAGTTGTATCTCTGTTGCCACTCGTTATGCCAGGAGACAGTGTCAGGGCCTCTATTGCATCAAACATGATGTCCGATGACATGTTAGGATTGTCTTTTCAATTAGCCTCCTTAGAAGAAAATGCCTCAGTTTATCTTTGGGTTGTGGTAGAGCTTGATAGAACAAATAGTGCAGGCTCAGAATCCGATCTAGGACTGTCTCCAGGAGGAAAAATCAAGCTCATTAAAAGTTCTTCAATCGCTGTGCAATCGCCCTTTAGGAACTTTCCAAACCGGAGTTGTTTGCAAGCACTCATTCTCAGATTCCTTCCTCATGATCCGAATCACGTTTATGTTGGCACAGACGGTGGTTATGTTGTTCATTGCGACAGACATGGCGGTCGAGCTTCACCGAAGGCCCACAGACCAGTAATAGACACCATAGAGCGAATAACAGCCATTGATTTGTCACCATGGCAGTTGCCTTGTATGCTATTAGGCAGTGAGACTGGCAATCTTTGGCTCTTTAACTTAAAAAATGAATTCCCACTGCTCAGTTGGCCATCAAGTACAAGCGGCAGTGCGATATTGTCCGTACGATGGTCTCACAGCAGACCCAGCGTGTTCTTCGTGTTGGATTCACAATCGAATCTACATGTCTGGGATTTACTTAAAAGTGACCAAGGCCCAATTACGGTGGAGAATTTCAAGCACAGCCGCGTAACGTGTTTTGAGCTGTCCAGCGATTATTCATCATCAGGAATTGGAATCCCAGGAAGGAACGCTGAACTGATATTGGTTTACGAAAGTGGAGCGGTGGAAATTCACAGAATAAGCAGTGTTTTCTCCAAGGCTTCTGGTGATGACATGGATCGATTTGCGAGCTATCTAGAGGGCGTGGTATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8WVS4	Cytoplasmic dynein 2 intermediate chain 1 OS=Homo sapiens OX=9606 GN=DYNC2I1 PE=1 SV=3
Q8C761	Cytoplasmic dynein 2 intermediate chain 1 OS=Mus musculus OX=10090 GN=Dync2i1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003655 (this species only) · gene tree & orthology

Pfam domain

No Pfam domain signature was recorded for XP_074622602.1 in Acropora palmata.

InterPro

InterPro term	Type	Description	Source
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR042505 all species →	Family	Cytoplasmic dynein 2 intermediate chain 1	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16022 all species →	WD REPEAT DOMAIN 60	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005868 all species →	Cellular Component	cytoplasmic dynein complex	Interproscan
GO:0042073 all species →	Biological Process	intraciliary transport	Interproscan
GO:0045503 all species →	Molecular Function	dynein light chain binding	Interproscan
GO:0045504 all species →	Molecular Function	dynein heavy chain binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K22869	WDR60; WD repeat-containing protein 60	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074622602.1 across 84 RNA-seq samples of Acropora palmata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

0TPM > 0

2Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	0	0.00	0.00
all_coral_tissue · baseline	38	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.