Gene detail

Detailed information of XP_074622784.1 in Acropora palmata

Genomic Location: NC_133886.1:19744423...19761814
NR annotation: XP_029208164.2, TBC1 domain family member 5-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074622784.1

ATGGAGAAGTCTTCAACTGAACGATTGACCCAGTGCAGTGAAGACATCTTAGCAACATTGGATCGGTTTGGCTCAAAATCGCAGAGTCCTGTTGAAGATGAATACGACGATGACCAGTTCAACTCATCATCAGAAAGAGCGTCATTTATCAACGAACCTGTGGGAAGACTGAGTTTTATTTCTGCTGATGGTAGTGAAATTGACTCTGACTACAGCTCAGCTAGTTCAGTTTTTCATACTGGATCTGAAGAACAGAGGAACCTAGAGAGAGAATGGCAAGCTCTCTTTGGCTCATCTACATATTACGCAACGATTCGGCAGTATGGTTTGGATGGCAAGCTTCGCTCCACCAAGTTTAGGAGCATTTGTTGGAAGGTTTTTCTAGAATGTCTTCCTGAGCGAAAAGAAGAGTGGGTCTCAAGAACAACTAAACTAAGGAATGACTACACACAATTTAAAAGCAAATGTTTGTTTGATCCAAACAAAGGGAAGAAAGAGGAATCAGACCTGACGGTATTCAATCCGCTCTCTCAAGATGAAACGAGCCCGTGGAAACAGTACTTCATTGACAATGAGCTGAAGTCCACAATTAAGCAAGACCTGGACAGATTATTTCCAGAAATCGAGTTTTTCCAGCAGTCAAAAGTCAAGGAAATGATGCTTAATATTCTTTTTTGTCACGCCAAAAAGAACGAAGCTCTCAGCTATAAACAGGGAATGCATGAGCTTCTTGCTCCAATTGTTTATGTGCTGCATGAAGATGCGAGGAGTTTTCAGCATCTTGAAGGATCTAGTCTGAAAGTGGCGAAGGTTCTCATGGACTCGAATTTCCTGGAGCACGATGCGTTTGCACTCTTTGTTCAACTCATGGATCAGACAGAAACCTGGTACCTTCAACTACCAGTCGCAGATCGCTCCGAGCGAAATAAGTTTCTAGATCCTCACGCAGAACCTTTTGCCGATCAAGAACTCATGCCTTCCACAGCGATTGTCAAGAAACTCAGTCGTATTCAAGAGCATATGTTAAGGAAATACGATCCAGAACTGTGGGTTCACTTGAAGAATCTGGACATCACGCCGCAAGTCTATGGACTTCGTTGGATTCGTCTGTTGTTTGGTCGTGAGTTTCCCATGTATGATGTCCTTGTGTTATGGGATGCTTTGTTTGCCGACGGGCCAATGCTGAATTTGGTGGACTACGTATACATCAGCATGTTGGAAGCCATCAGAGACAAACTTCTTAGAGGGAGTTACTCGGCCTGTATGGGCTATCTGATGAAATTTCCTGGCGGATTTTCGGATGTGTACCGTTACGTGAAAACTGCTTTAATATTAAGAGAACACAAGACCACATCAGCTCGATCAAGTCCTTGCTTGCCAAATCCGCCGAAACATCCTCCTACGCATGCGTCCGCGACCTACCCTCGGCAGAAGAAACCTGAACCAAAGAAGCCGCCGTCAGCTTTCACGTCAATCACAAAGCGCTATCAACAGTTTGTGGAACCAATGAAACAAGGCGCTGCCGTGAAACCAGCCGTTAAGCCACAAGCCACCATTCCGGCAACGGCAGTCAACCGAGACGCTGAAGAACTTCTTCCCAAACATGGTCGGCCAGCTCGTCCAGCCTCAGTCCCAGCTCCCGAGATGAAAGGTGAACGTGTAGATTCTGGTTCCCAGTTCTCTACTCCAGGAAAGGGCGTAAGGTCAATTAAGGATAAGCTAATGACGCGGCCAAGAAATCGATCAAGGGCAGATTACGATGCATTGGCGCAGGACCACGAGCGACTTCAGAAACAAGTGTCGTCGTTGAAAACCGAGCTGGATAGAATGCAGGGTTTGTACCTGTATTGTGGCAGGAAAATGGATTCTTACATTGATCTTCTTCAAGATGAGCTAACGAGGGAGGAGGATTCCGTCTGTGATGTTGTTTACTTGTGCTTAGCTGGCTTAAAGCAGGTACGGGATTTACTGAAAGGGACTTTGCCGTTTCGTGGTTCAACTATGGAGACAGAGTGTGACTTCATGGAGATAGATAACAACATTGCTTCGCGTTTGCGAGTACCTTGTCTTCCACAACAAAAAGAAAGTGAGATTCCCGAAACTCTACCAGTGCCGATGCTGGCGAATTTCGATCATTTTCAGCCTGACAACGACGAAAAAGAAAGTACTTTCATGACTAATATCGATGCCAAGCAAGGCGGTGAAAATGCAGGTTCGAGCGAACCTCTAGCTGATTTCGAAAATGGTGAGGTTTCAGAAAGCAATGGTGAAAAACATGTTGGCTTAGACAATGCGAGTAGTGATGTCTTGAAAAATGAAGGATATGTTGGAAATGACGAAGAAGCAGCTTCAAGTTTCGTCCAAGGACAACAAGAGGACCAGTCTGACGGTTCCGTTTCGTTATTTTGTGCAGATTCTAAATACAAATCGGCGGAGGAAACGAGATCTAATGATCGGTCGATGAGCACAAATGATTCGTTTTCTGACAACGAACCAATTACAGAAGATAAAATTGCTCAATCCGACCAGCAGTGTGACCAAGGGAATGTTGGGGATACCATGTTACGCCCAGACCACGGCGTTAGGGATCCTCTTGGTAACCAAACGTCACACCCACCAATTGACTCTGAGAGCGATTACGCTGATACGGGTCGGACGGATTCTGTGGACCGCGAGTTTGTGTTTGTCAATCAGGACGGGACAGCCCAGGTGTCACCTTTGCATCCTTTGGAGGAGAGCGACGATTATTTTTACTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q92609	TBC1 domain family member 5 OS=Homo sapiens OX=9606 GN=TBC1D5 PE=1 SV=1
Q80XQ2	TBC1 domain family member 5 OS=Mus musculus OX=10090 GN=Tbc1d5 PE=1 SV=2
Q54TA5	TBC1 domain family member 5 homolog B OS=Dictyostelium discoideum OX=44689 GN=tbc1d5B PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004119 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00566 all species →	RabGAP-TBC	Rab-GTPase-TBC domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000195 all species →	Domain	Rab-GAP-TBC domain	Interproscan
IPR035969 all species →	Homologous_superfamily	Rab-GAP-TBC domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22957 all species →	TBC1 DOMAIN FAMILY MEMBER GTPASE-ACTIVATING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0090630 all species →	Biological Process	activation of GTPase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18469	TBC1D5; TBC1 domain family member 5	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074622784.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

72TPM > 0

2Conditions

60.1Max TPM

23.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	37	20.31	60.08
all_coral_tissue · baseline	38	35	26.79	50.78

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.08
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.93
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.56
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.44
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.17
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.01
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.74
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.01
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.16
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.11
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.56
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.00
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.64
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.71
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.71
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.18
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.54
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.89
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.49
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.96
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.84
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.92
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.37
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.08
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.84
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.09
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.93
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.34
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.36
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.77
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.72
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.51
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.73
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.45
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.28
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.26
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.03
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.78
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.53
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.05
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.86
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.56
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.21
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.46
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.08
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.89
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.27
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.59
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.34
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.98
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.68
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.55
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.83
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.71
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.66
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.35
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.18
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.32
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.99
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.43
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.96
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.10
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.07
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.91
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.65
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.59
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.59
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.73
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.12
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.28
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.65
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.14
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.