Gene detail

Detailed information of XP_074622983.1 in Acropora palmata

Genomic Location: NC_133886.1:19932408...19954031
NR annotation: XP_044178691.1, ATP-dependent zinc metalloprotease FTSH 4, mitochondrial-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074622983.1

ATGTTTTCATCCTCTGGGATCAGTCCCCAGGCTGGGGGAATCCTGCCACAAGTGACAGCACTGCTCAATGGCTTAAAAAACACATCCTTAGGAAGATATTTGACGTATGCACAGATAAAAACACAACATGCTAAAAACCCAAAATCCACAATAGAACAGAAAACAGCTGTGGAGTCAAGCCCAGACCATGCAACACTGGATTCTTATGCAACATTTTTGGGGGAGCTTGGCATAGCATCAGTCCCGGCTGAAGTGTTAAGGCAGCTCAGCACTCCACTGTCAGTCTGTCGCTGCAGTGCAAATAACAGCAGTCCATGGAAAGTGTCTCATGTCTCTTCAGAATCTTTCTTCAAGAACAAACATGGATTTTCAAGTTTAACACTTTCCCGACCAAATCCTTCCAGGGTCAAATCGAATATCTTCACATCCTTTACAAAGCTACCCTGGTTACGCACATCATTTTTCAAAAGCTACTCAGGACGAGGATATCATTCAGTTCCTTTGAGAAAAATACAGCAGCTTGAAGAAAGAGCAAATGCAGAAGAAAATAATCCCAGGGCACAAGCAGAGTATTTAAAGGCTTTGGTCCAAGAGGATCCAAATTATGTCATACAGAGATACGAGAGCGGAAAATATGCGGTTGATGACTCAGTAACCAAAGAATACTTAATGGCCTTGGTCTTAGCAGGGAAAATAGGGAGTGCAAACACTGTTAACCTGAGACAACGGAGCCCTGTTTTACCAGAAACAATGCCAGCTTCGGCGGCGGCCAGCATCCAAACTGGAACAGAGGAAAATCCCACGTATGTTATAATGCAAAACCAGAAAGGTGCCTTTTTCAAGGAACAACTATGGAACACGTTCAGATTTCTCATTGCTCTGTTTCTGGTCCTGTCCCTAATCGAGGCACAGCTGCAGATGAAGATGAGCTCAAACCAAAAGGACATTCAACCTGACAGCTTGGATCGGAACACTCGATTCACTGATGTTCAAGGGGTGGAAGAAGCCAAACAGGAGTTGAAAGATGTGGTGGAATTTTTACGGGACCCAGAAAGGTTCAAGAGGCTTGGAGGCAAAATGCCAACGGGTGTTCTCCTAACTGGTAGGCCTGGGACTGGAAAAACACTCCTTGCTAAAGCTGTCGCCGGCGAAGCTGGAGTGCCATTTTTCTTCTGCTCTGGTTCAGAGTTTGACGAAATGTTTGTTGGTGTTGGAGCTGCAAGGGTTCGAAATCTTTTCTCTGCTGCTAGGGAACATGCGCCGTGCATAGTATTCATTGACGAATTGGATGCCATTGGGGGCACGAGAATTGTGCATGAACACCAGCCCTACTCAAGGATGACCCTAAACCAGCTGCTTGTCGAGTTGGATGGATTTGACAAATCCGAAGGAATTGTGGTCATTGGAGCCACCAACTTTCCTGAAATTCTGGACAAAGCCCTTGTCAGACCGGGTCGATTCGACACTAAGATTCATGTTCCAATGCCAGATATCAAAGGCCGGCACGACATTCTCAAGCTTCACCTCAAGACAGTTGAAGTTGCCGACGATGTCAACATTGAAGTTCTTGCCAGGGGAACAACGGGCTTCTCGGGCGCGGACCTCGCGAATCTGGTAAACGCTGCTGCAATTTACGCGGCGGCGGAAGGTGACCAGAGTGTCACGACCAGACATCTTGAATTTGCCAGAGACAAGATTCTCATGGGCCCCGAACGGAAAAGTGCCGTCATTGAGGCTAAGAACAGAGAAATGGTAGCCTACCACGAGGGGGGACATGCACTTGTGGCTCTGTACACTCCGGCAGCGCTTCCGATTTACAAGGCCACGATTGTACCTCGCGGTTCAGCTCTTGGAATGGTCGCGCAGTTGCCAGAGAAGGATGAACTGAATTGGTCCAAAGCACAGCTGCTAGCGAGACTAGATGTTGCAATGGGCGGACGAGTTGCCGAGGAGATCATATTTGGAAAGGAAAACGTAACCACTGGTGCTGCAAGCGACATGGAATCCTCGACCAAGCTTGCACGTGCTATGGTGACTATGTACGGAATGAGTGACAAGGTTGGAATGATTCAAATTAAGGATGACGACAAATCAAGCCCAGAGTTACAGGCACTGGTCGAGAATGAGATCAAACAACTGCTGAAGGAGTCTTACGAGAGGGCTAAGACCTTACTTCAAGCGCATTCGAAAGAGCACAACCGCCTGGCCCAAGCCCTGCTGAAGTACGAGACACTCGACTTGGAAGAAATCAAAGTCGTTATTCAAGGAAGGAATCTCTCCAGGACTCTTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8LQJ9	ATP-dependent zinc metalloprotease FTSH 4, mitochondrial OS=Oryza sativa subsp. japonica OX=39947 GN=FTSH4 PE=3 SV=1
O80983	ATP-dependent zinc metalloprotease FTSH 4, mitochondrial OS=Arabidopsis thaliana OX=3702 GN=FTSH4 PE=1 SV=2
Q8LQJ8	ATP-dependent zinc metalloprotease FTSH 5, mitochondrial OS=Oryza sativa subsp. japonica OX=39947 GN=FTSH5 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003080 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01434 all species →	Peptidase_M41	Peptidase family M41	Domain	Interproscan
PF00004 all species →	AAA	ATPase family associated with various cellular activities (AAA)	Domain	Interproscan
PF21232 all species →	Yme1-like_N	Yme1-like, N-terminal	Domain	Interproscan
PF17862 all species →	AAA_lid_3	AAA+ lid domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR037219 all species →	Homologous_superfamily	Peptidase M41-like	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR005936 all species →	Family	ATP-dependent zinc metalloprotease, FtsH	Interproscan
IPR000642 all species →	Domain	Peptidase M41	Interproscan
IPR003959 all species →	Domain	ATPase, AAA-type, core	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR048438 all species →	Domain	Yme1-like, N-terminal domain	Interproscan
IPR003960 all species →	Conserved_site	ATPase, AAA-type, conserved site	Interproscan
IPR041569 all species →	Domain	AAA ATPase, AAA+ lid domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23076 all species →	METALLOPROTEASE M41 FTSH	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004176 all species →	Molecular Function	ATP-dependent peptidase activity	Interproscan
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005743 all species →	Cellular Component	mitochondrial inner membrane	Interproscan
GO:0006515 all species →	Biological Process	protein quality control for misfolded or incompletely synthesized proteins	Interproscan
GO:0007005 all species →	Biological Process	mitochondrion organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08955	YME1; ATP-dependent metalloprotease	EC:3.4.24.-	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074622983.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

73TPM > 0

2Conditions

64.6Max TPM

32.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	39	28.39	54.07
all_coral_tissue · baseline	38	34	36.87	64.60

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.07
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.46
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.70
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.71
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.32
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.25
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.62
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.61
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.25
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.62
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.38
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.85
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.73
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.12
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.01
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.65
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.40
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.35
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.46
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.73
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.78
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.57
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.37
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.59
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.86
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.47
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.38
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.81
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.68
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.34
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.22
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.49
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.29
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.53
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.20
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.24
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.57
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.61
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.69
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.60
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.35
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.11
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.78
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.70
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.10
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.38
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.31
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.69
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.58
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.53
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.77
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.65
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.35
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.08
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.46
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.13
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.06
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.79
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.41
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.88
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.20
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.00
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.37
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.21
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.22
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.59
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.33
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.38
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.38
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.11
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.39
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.18
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.