Gene detail

Detailed information of XP_074623403.1 in Acropora palmata

Genomic Location: NC_133886.1:19141810...19168968
NR annotation: XP_029207899.2, uncharacterized protein LOC114971517 isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074623403.1

ATGAAGCCGACAGATCACGAAAGCTCGTCTTTTGATTCCAATTCTGGTATATCAATTAACGCCATTAGAACGCTTCTGTACATGTGCATTGCTGATCAGTACAAAAATATGTCCTCCGCTGTCATGAAAAAGGATATAAATTCAGGATCCCAATTGCAATCCTTTGGGACCAGCGATTACTTCGAAATTTCCTCGACGAAGGCGTTGAAAGAGTCTCAGTATGATAATAACTTATCTGCAAATGGTACAGTAACCAAAAAGCCAACAGAACAGGATGATTTGGCAGTGAAAGCATTTTACACCAGCAAGTATATGGACATGGACAGTCCTATCATACCCTGTGATGACAATAACGAAGTATCCAGTGGTCAGATCCCCAGCCTGACATGTACTGCCTCCGAATGGAGTGGTCCTCCATCAAGCTGTGCAAGGGAGACAAGCACTGTCTCACTTGAAAGTGTTAAGAAGTTGAAGAGACCAGTCCTTAAAGTTGACATTGCTCAAGCAAAGGCAATGCAAGCTGTAACTTGCCCACCTTATTCAAGTTATAAGGACCCTGAAGTGAACTTTGAGGCATTGGTACATGTAGAGAAAGCCTTTACTTGTCGACATAACATGCGAGCCTGGGAGGAGTGCAATGACGAGCACTGCCAAGTCCTCCAACAATTTCTTAGACACAGGCAGAATTGCCATATGCGTGTCCTGGGGGGATGTGAGCAATGCATTCACTTTAAGGATGCTCTGCAGTCCCATGCATCCACCTGTGAGGAGCTCCCTGGAAAATGCGTGGTGAACAAATGTGATGACATCAGAGAGTACATGAAAAATAACGCCTTGCCAGACAACAGGAATTGGAAGTACAATCATGATAAGTTGTTCTTTGAGCCCAGTCCACCAAGAACACCTGCAGTGACCTTGCCTGGAAATCTCTGCCCGTTGCCATTTGAAGCCAGTGAATCTGCCAGTGAGTTTGCTTCCTTTGCATCAGACAATGGTGAAAACTCATCTACAAGTGCAACCACCTTACAGAACCAGTGTAATGTTGTCCGAGAGCCAGACTTTGGATCAGACCTGTTCTCAGGGGTAAACTTGATGCAACAGCAACACCTACAGAATGTGGAACAACCATCGAATTGTTCAGCAAGGAATGGCATGGCTAGCTTGCAGCCAAGTAGAGTGGAGGAAGAAGACGAACTTCCTGCTTCACCTCTAAGTGCCTCAAGTATGCCTGGCGTGAGCCAGGCTTCTGCTGGTGTGTCCATCCCTCAGGAGGTCCTTTGGCCCCTCAATAGGGCACACTTGAGTGTTGGTGACGATGGAAGTTATGTGGAAAATGTTCATTGGAAACGGATAATCTACATTGGAGGAGGGTCTTGCGGCCGTTGTCATCAGTGCATGGATTTGAAGACAGGAAAGCTGTTTGCTATTAAATTTATCAGAGAAGATAGTTTTGAAGTGACTGGATTGGAGATCTGGGGGACCATGTCAGGAAGGCATGACAATATCCTGGAGCTGTATGGAGCAGTTAAATCATGTGGCAAGATAACAATTTTTATGGAGTACATGAGTGGTGGCTGTGTAGAAGAAGCCGGAAAATTACATGAAGGACTGGCCCTCAATATTTTCTCTGAGATATTGTCTGCTGTACAATTCATGCACTCTCTTGGATTTGTTCACCGGGATATCAAAGGGGCGAATATTCTCATAGACTCCACAGGAGAAAAAGTCAAGCTAGCTGACTTTGATACAAGTATCAAACTTGACAACGGTTATCAGCAGGATAACAATCCAAGAGGAACAGAGGCCTTTATGGCCCCTGAGGTTTGTCGAAGCCAAAATCATTCCTTTAGTGCTGACATCTGGAGTGCGACTTGTGTGCTCTATCAAATGCTTAAGGGGACTCCACCTTGGGAGCAATATCATCACTGTCATCGGATGACTCTTCTCTACCAGATTGGTGTGGCTCCCCAACCTCCCCCCTCACCGACATGCAGTCCTGAAGTTGAAGATCTCTTTAGCCTGGGATTTCGACTCAGGCCAGAAGAAAGAGGAACAGCAACCGAACTGTTGAATCACAGATCATTTAATTCAGCACCACATAAGTCAAATATGCAGCTTTCTAGGAGTTGTTCCACATATGATTCTGATTACGAAAGCAACCTCTGCAACGCTTTTGATTTAGAGTTATCAAATGCAGACGATGATGACGAGTTTAGCGAAAACGAGACTCGCAGAAGTGACGCAAGTAGTGCCGACGCCGATCATGATTATGACGATGACGCAGATTATGACGATGACGCAGATGAAGATGTTGACGACTACGGCGATGACGTCATTGGCGTTGGAGACGGTGCCAGTGGTAGCGCCAACGCGGCAGCCTTGGTCGTATCAAGTACTGAAGGCGAATGGCAAGGGCAGAGGAGTGCAGCTTCATCAACAGAGCAGCAGTTACACTCGTTGCAAAGTGATTTATTCTTCAGCCTTCCAGCTGAAGAATTGAGTAAATTGGTTGTCACTGAGATTTGTGAAGACTCCTATATGACAGACAATGACGTCAACGAGGTCATTAGCAGCGAGGAAGACTTCGATTATCAAAGCATAATCGGTCAAATCAGCATGAATGCGAGCCAGGCCTCCCGCCAGGATGGGTCGTATTCTGTTTCAGATTTGACAAAGGTCAACATAACAGACATCGATGGAAACATCATGTTTTCAATCCGCGAGAGGCCTACAACAACTTATGGCACTTTGGGGAGAGATCTCCATGGAAACATCACTAATGTGTTTGGGATTGAGGCGTTTGTTTTGGTGCAGGATGATGGTGTTACCCCGCTTGATGTACACGCCGAGATCGGTGAGCACGAACAAGCGCTGAGGGTTTTCCGAGCGCATGACACAGACGACTGGCAGCCCTTCCGCTGGAGAGTAAATCTTTTTGGGCTTGTGGAGCAAAGCTTGCCTGCTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P53349	Mitogen-activated protein kinase kinase kinase 1 OS=Mus musculus OX=10090 GN=Map3k1 PE=1 SV=3
Q13233	Mitogen-activated protein kinase kinase kinase 1 OS=Homo sapiens OX=9606 GN=MAP3K1 PE=1 SV=4
Q9Y6R4	Mitogen-activated protein kinase kinase kinase 4 OS=Homo sapiens OX=9606 GN=MAP3K4 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006079 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035898 all species →	Homologous_superfamily	TAZ domain superfamily	Interproscan
IPR050538 all species →	Family	Mitogen-activated protein kinase kinase kinase	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48016 all species →	MAP KINASE KINASE KINASE SSK2-RELATED-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074623403.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074623403.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

66TPM > 0

2Conditions

66.6Max TPM

16.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	34	13.01	32.66
all_coral_tissue · baseline	38	32	21.63	66.62

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.66
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.17
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.02
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.98
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.88
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.13
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.29
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.26
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.93
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.16
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.86
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.18
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.56
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.65
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.34
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.09
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.80
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.63
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.63
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.43
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.85
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.84
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.28
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.01
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.67
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.19
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.91
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.51
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.45
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.42
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.37
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.20
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.16
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.07
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.62
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.76
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.69
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.57
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.89
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.24
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.49
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.40
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.54
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.50
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.99
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.85
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.32
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.43
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.05
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.57
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.20
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.79
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.86
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.23
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.83
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.64
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.96
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.62
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.63
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.98
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.47
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.09
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.03
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.10
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.96
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.60
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.